Regulon of ScrR in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_031840
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -169 Score: 7.3 Sequence: TATGTCAATCGGTTGACATA Locus tag: RBAM_031840 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	RBAM_031840	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family
Position: -241 Score: 7.3 Sequence: TATGTCAACCGATTGACATA Locus tag: RBAM_031830 Name: cscB Funciton: Sucrose permease, major facilitator superfamily Locus tag: RBAM_031820 Name: cscA Funciton: Sucrose hydrolase (EC 3.2.1.26)
	RBAM_031830	cscB	Sucrose permease, major facilitator superfamily
	RBAM_031820	cscA	Sucrose hydrolase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD