Regulon of ScrR in Paenibacillus sp. JDR-2

Properties
Regulator type:	Transcription factor
TF locus tag:	Pjdr2_5212
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -122 Score: 7.3 Sequence: TATGTCAACCGGATGACATA Locus tag: Pjdr2_5212 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	Pjdr2_5212	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family
Position: -103 Score: 7.3 Sequence: TATGTCATCCGGTTGACATA Locus tag: Pjdr2_5213 Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein Locus tag: Pjdr2_5214 Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 Locus tag: Pjdr2_5215 Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein Locus tag: Pjdr2_5216 Name: sacC Funciton: Levanase (EC 3.2.1.65)
	Pjdr2_5213	sacH	Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein
	Pjdr2_5214	sacG	Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2
	Pjdr2_5215	sacF	Predicted fructose oligosaccharide ABC transporter, substrate-binding protein
	Pjdr2_5216	sacC	Levanase (EC 3.2.1.65)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD