Regulon of ScrR in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC3120
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 7.6 Sequence: TATGTCAACCGGTTGACATA Locus tag: ABC3119 Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein Locus tag: ABC3118 Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 Locus tag: ABC3117 Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein Locus tag: ABC3116 Name: sacC Funciton: Levanase (EC 3.2.1.65) Locus tag: ABC3115 Name: cscA Funciton: Sucrose hydrolase (EC 3.2.1.26)
	ABC3119	sacH	Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein
	ABC3118	sacG	Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2
	ABC3117	sacF	Predicted fructose oligosaccharide ABC transporter, substrate-binding protein
	ABC3116	sacC	Levanase (EC 3.2.1.65)
	ABC3115	cscA	Sucrose hydrolase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD