Regulon of ScrR in Bacillus licheniformis DSM 13

Properties
Regulator type:	Transcription factor
TF locus tag:	BLi04183
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Bacillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -157 Score: 7.6 Sequence: TATGTCAACCGGTTGACATA Locus tag: BLi04183 Name: scrR Funciton: Sucrose utilization transcriptional regulator ScrR, LacI family
	BLi04183	scrR	Sucrose utilization transcriptional regulator ScrR, LacI family
Position: -97 Score: 7.6 Sequence: TATGTCAACCGGTTGACATA Locus tag: BLi04182 Name: sacF Funciton: Predicted fructose oligosaccharide ABC transporter, substrate-binding protein Locus tag: BLi04181 Name: sacH Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein Locus tag: BLi04180 Name: sacG Funciton: Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2 Locus tag: BLi04179 Name: cscB Funciton: Sucrose permease, major facilitator superfamily Locus tag: BLi04178 Name: cscA Funciton: Sucrose hydrolase (EC 3.2.1.26)
	BLi04182	sacF	Predicted fructose oligosaccharide ABC transporter, substrate-binding protein
	BLi04181	sacH	Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein
	BLi04180	sacG	Predicted fructose oligosaccharide ABC transporter, membrane-spanning permease protein 2
	BLi04179	cscB	Sucrose permease, major facilitator superfamily
	BLi04178	cscA	Sucrose hydrolase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD