Regulog SMb21706 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 1 | 1 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | 5 | 1 |
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | 6 | 1 |
| Rhizobium leguminosarum bv. viciae 3841 | 12 | 3 |
| Rhizobium sp. NGR234 | 2 | 1 |
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | 6 | 1 |
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| SMb21706 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -56 score = 5.95768 sequence = TTGAAAAAACGATTTCTCAC Site: position = -78 score = 6.10584 sequence = CAGAGAAAACGTTTTCTCTA Gene: Atu5078: Transcriptional regulator, LacI family |
|
|
|
|
|
*
Mesorhizobium loti MAFF303099 Site: position = -149 score = 6.24137 sequence = TTGAGAAAAGGTTTTTCCAA Site: position = -81 score = 6.22365 sequence = AAGAGAAAACCTTTTCCCAA Gene: mlr2242: Transcriptional regulator, LacI family |
|
|
*
Rhizobium etli CFN 42 Site: position = -150 score = 6.21307 sequence = TTGGTAAAAGCTTTTCTCAA Site: position = -182 score = 6.60819 sequence = ATGAGAAAACCTTTTCTCAC Gene: RHE_CH03845: Transcriptional regulator, LacI family |
*2
Rhizobium leguminosarum bv. viciae 3841 Site: position = -72 score = 5.44887 sequence = TTGATAAAACCTTTTAACAG Site: position = -41 score = 5.35947 sequence = CTGCTAAAAGCTTTTATCAT Gene: pRL100262: Transcriptional regulator, LacI family Site: position = -71 score = 6.60819 sequence = ATGAGAAAACCTTTTCTCAC Site: position = -39 score = 6.05395 sequence = TTGGTAAAAGCTTTTCTCAG Gene: RL4378: Transcriptional regulator, LacI family |
*
Rhizobium sp. NGR234 Site: position = -45 score = 6.69502 sequence = ATGAGAAAACGTTTTCTCAT Gene: NGR_b18600: Transcriptional regulator, LacI family |
|
*
Sinorhizobium meliloti 1021 Site: position = -297 score = 6.51017 sequence = GTGAGAAAACCTTTTCTCAG Site: position = -264 score = 6.72782 sequence = TTGAGAAAAGGTTTTCTCAT Gene: SMb21706: Transcriptional regulator, LacI family |
|
Transcriptional regulator, LacI family |
| SMb20634 |
|
|
|
|
|
|
Gene: mlr2244: sugar ABC transporter, periplasmic solute-binding protein |
|
|
Gene: RHE_CH03844: sugar ABC transporter, periplasmic solute-binding protein |
*2
Rhizobium leguminosarum bv. viciae 3841 Gene: RL4377: sugar ABC transporter, periplasmic solute-binding protein Site: position = -127 score = 5.44887 sequence = CTGTTAAAAGGTTTTATCAA Site: position = -158 score = 5.35947 sequence = ATGATAAAAGCTTTTAGCAG Gene: pRL100263: sugar ABC transporter, periplasmic solute-binding protein |
Gene: NGR_b18590: sugar ABC transporter, periplasmic solute-binding protein |
|
Gene: SMb20634: sugar ABC transporter, periplasmic solute-binding protein |
|
sugar ABC transporter, periplasmic solute-binding protein |
| SMb20633 |
Gene: Atu5080: sugar ABC transporter, permease protein |
|
|
|
|
|
Gene: mlr2245: sugar ABC transporter, permease protein |
|
|
Gene: RHE_CH03843: sugar ABC transporter, permease protein |
2
Rhizobium leguminosarum bv. viciae 3841 Gene: RL4376: sugar ABC transporter, permease protein Gene: pRL100264: sugar ABC transporter, permease protein |
Gene: NGR_b18580: sugar ABC transporter, permease protein |
|
Gene: SMb20633: sugar ABC transporter, permease protein |
|
sugar ABC transporter, permease protein |
| SMb20632 |
Gene: Atu5081: sugar ABC transporter, permease protein |
|
|
|
|
|
Gene: mlr2246: sugar ABC transporter, permease protein |
|
|
Gene: RHE_CH03842: sugar ABC transporter, permease protein |
2
Rhizobium leguminosarum bv. viciae 3841 Gene: RL4375: sugar ABC transporter, permease protein Gene: pRL100265: sugar ABC transporter, permease protein |
Gene: NGR_b18570: sugar ABC transporter, permease protein |
|
Gene: SMb20632: sugar ABC transporter, permease protein |
|
sugar ABC transporter, permease protein |
| PF07944 |
Gene: Atu5082: Protein of unknown function DUF1680 |
|
|
|
|
|
Gene: mlr2247: Protein of unknown function DUF1680 |
|
|
Gene: RHE_CH03841: Protein of unknown function DUF1680 |
2
Rhizobium leguminosarum bv. viciae 3841 Gene: RL4374: Protein of unknown function DUF1680 Gene: pRL100266: Protein of unknown function DUF1680 |
Gene: NGR_b18560: Protein of unknown function DUF1680 |
|
Gene: SMb20631: Protein of unknown function DUF1680 |
|
Protein of unknown function DUF1680 |
| SMb20630 |
Gene: Atu5083: sugar ABC transporter, ATP binding protein |
|
|
|
|
|
|
|
|
Gene: RHE_CH03840: sugar ABC transporter, ATP binding protein |
2
Rhizobium leguminosarum bv. viciae 3841 Gene: RL4373: sugar ABC transporter, ATP binding protein Gene: pRL100267: sugar ABC transporter, ATP binding protein |
Gene: NGR_b18550: sugar ABC transporter, ATP binding protein |
|
Gene: SMb20630: sugar ABC transporter, ATP binding protein |
|
sugar ABC transporter, ATP binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |