Regulon of SMb21706 in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu5078
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21706 - Rhizobiales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 6.1 Sequence: CAGAGAAAACGTTTTCTCTA Position: -56 Score: 6 Sequence: TTGAAAAAACGATTTCTCAC Locus tag: Atu5078 Name: SMb21706 Funciton: Transcriptional regulator, LacI family
	Atu5078	SMb21706	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD