Regulon of SMb21706 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL4378, pRL100262
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21706 - Rhizobiales
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -158 Score: 5.4 Sequence: ATGATAAAAGCTTTTAGCAG Position: -127 Score: 5.4 Sequence: CTGTTAAAAGGTTTTATCAA Locus tag: pRL100263 Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein Locus tag: pRL100264 Name: SMb20633 Funciton: sugar ABC transporter, permease protein Locus tag: pRL100265 Name: SMb20632 Funciton: sugar ABC transporter, permease protein Locus tag: pRL100266 Name: PF07944 Funciton: Protein of unknown function DUF1680 Locus tag: pRL100267 Name: SMb20630 Funciton: sugar ABC transporter, ATP binding protein
	pRL100263	SMb20634	sugar ABC transporter, periplasmic solute-binding protein
	pRL100264	SMb20633	sugar ABC transporter, permease protein
	pRL100265	SMb20632	sugar ABC transporter, permease protein
	pRL100266	PF07944	Protein of unknown function DUF1680
	pRL100267	SMb20630	sugar ABC transporter, ATP binding protein
Position: -71 Score: 6.6 Sequence: ATGAGAAAACCTTTTCTCAC Position: -39 Score: 6.1 Sequence: TTGGTAAAAGCTTTTCTCAG Locus tag: RL4378 Name: SMb21706 Funciton: Transcriptional regulator, LacI family Locus tag: RL4377 Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein Locus tag: RL4376 Name: SMb20633 Funciton: sugar ABC transporter, permease protein Locus tag: RL4375 Name: SMb20632 Funciton: sugar ABC transporter, permease protein Locus tag: RL4374 Name: PF07944 Funciton: Protein of unknown function DUF1680 Locus tag: RL4373 Name: SMb20630 Funciton: sugar ABC transporter, ATP binding protein
	RL4378	SMb21706	Transcriptional regulator, LacI family
	RL4377	SMb20634	sugar ABC transporter, periplasmic solute-binding protein
	RL4376	SMb20633	sugar ABC transporter, permease protein
	RL4375	SMb20632	sugar ABC transporter, permease protein
	RL4374	PF07944	Protein of unknown function DUF1680
	RL4373	SMb20630	sugar ABC transporter, ATP binding protein
Position: -72 Score: 5.4 Sequence: TTGATAAAACCTTTTAACAG Position: -41 Score: 5.4 Sequence: CTGCTAAAAGCTTTTATCAT Locus tag: pRL100262 Name: SMb21706 Funciton: Transcriptional regulator, LacI family
	pRL100262	SMb21706	Transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD