Regulon of SMb21706 in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mlr2242
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21706 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -149 Score: 6.2 Sequence: TTGAGAAAAGGTTTTTCCAA Position: -81 Score: 6.2 Sequence: AAGAGAAAACCTTTTCCCAA Locus tag: mlr2242 Name: SMb21706 Funciton: Transcriptional regulator, LacI family Locus tag: mlr2244 Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein Locus tag: mlr2245 Name: SMb20633 Funciton: sugar ABC transporter, permease protein Locus tag: mlr2246 Name: SMb20632 Funciton: sugar ABC transporter, permease protein Locus tag: mlr2247 Name: PF07944 Funciton: Protein of unknown function DUF1680
	mlr2242	SMb21706	Transcriptional regulator, LacI family
	mlr2244	SMb20634	sugar ABC transporter, periplasmic solute-binding protein
	mlr2245	SMb20633	sugar ABC transporter, permease protein
	mlr2246	SMb20632	sugar ABC transporter, permease protein
	mlr2247	PF07944	Protein of unknown function DUF1680

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD