Regulon of SMb21706 in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH03845
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21706 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -182 Score: 6.6 Sequence: ATGAGAAAACCTTTTCTCAC Position: -150 Score: 6.2 Sequence: TTGGTAAAAGCTTTTCTCAA Locus tag: RHE_CH03845 Name: SMb21706 Funciton: Transcriptional regulator, LacI family Locus tag: RHE_CH03844 Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein Locus tag: RHE_CH03843 Name: SMb20633 Funciton: sugar ABC transporter, permease protein Locus tag: RHE_CH03842 Name: SMb20632 Funciton: sugar ABC transporter, permease protein Locus tag: RHE_CH03841 Name: PF07944 Funciton: Protein of unknown function DUF1680 Locus tag: RHE_CH03840 Name: SMb20630 Funciton: sugar ABC transporter, ATP binding protein
	RHE_CH03845	SMb21706	Transcriptional regulator, LacI family
	RHE_CH03844	SMb20634	sugar ABC transporter, periplasmic solute-binding protein
	RHE_CH03843	SMb20633	sugar ABC transporter, permease protein
	RHE_CH03842	SMb20632	sugar ABC transporter, permease protein
	RHE_CH03841	PF07944	Protein of unknown function DUF1680
	RHE_CH03840	SMb20630	sugar ABC transporter, ATP binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD