Regulon of SMb21706 in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb21706
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SMb21706 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -297 Score: 6.5 Sequence: GTGAGAAAACCTTTTCTCAG Position: -264 Score: 6.7 Sequence: TTGAGAAAAGGTTTTCTCAT Locus tag: SMb21706 Name: SMb21706 Funciton: Transcriptional regulator, LacI family Locus tag: SMb20634 Name: SMb20634 Funciton: sugar ABC transporter, periplasmic solute-binding protein Locus tag: SMb20633 Name: SMb20633 Funciton: sugar ABC transporter, permease protein Locus tag: SMb20632 Name: SMb20632 Funciton: sugar ABC transporter, permease protein Locus tag: SMb20631 Name: PF07944 Funciton: Protein of unknown function DUF1680 Locus tag: SMb20630 Name: SMb20630 Funciton: sugar ABC transporter, ATP binding protein
	SMb21706	SMb21706	Transcriptional regulator, LacI family
	SMb20634	SMb20634	sugar ABC transporter, periplasmic solute-binding protein
	SMb20633	SMb20633	sugar ABC transporter, permease protein
	SMb20632	SMb20632	sugar ABC transporter, permease protein
	SMb20631	PF07944	Protein of unknown function DUF1680
	SMb20630	SMb20630	sugar ABC transporter, ATP binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD