Regulog CueR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pasteurellales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Haemophilus influenzae Rd KW20 | 4 | 2 |
| Aggregatibacter aphrophilus NJ8700 | 4 | 2 |
| Pasteurella multocida subsp. multocida str. Pm70 | 2 | 1 |
| Mannheimia succiniciproducens MBEL55E | 3 | 2 |
| Actinobacillus succinogenes 130Z | 2 | 2 |
| Haemophilus somnus 2336 | 3 | 2 |
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | 4 | 2 |
| Haemophilus ducreyi 35000HP | ||
| Haemophilus parasuis SH0165 | 1 | 1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| cueR |
*
Haemophilus influenzae Rd KW20 Site: position = -34 score = 4.9694 sequence = ACCTTTACATAAGGTTAAGGT Gene: HI0293: Copper-responsive transcriptional regulator, MerR family |
*
Aggregatibacter aphrophilus NJ8700 Site: position = -33 score = 5.19629 sequence = ACCTTAACGTTAGGTTAAGGT Gene: NT05HA_0167: Copper-responsive transcriptional regulator, MerR family |
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -55 score = 5.79044 sequence = ACCTTGACCTAAGGGGAAGGT Gene: MS0886: Copper-responsive transcriptional regulator, MerR family |
*
Actinobacillus succinogenes 130Z Site: position = -63 score = 4.99954 sequence = ACCTTGACGTAAGGGTAAAGT Gene: Asuc_1033: Copper-responsive transcriptional regulator, MerR family |
*
Haemophilus somnus 2336 Site: position = -72 score = 4.40278 sequence = ACCTTGCGTTAGGGTCAAGGA Gene: HSM_1728: Copper-responsive transcriptional regulator, MerR family |
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -35 score = 4.79492 sequence = TCCTTAACCCTAGGTTAAGGT Gene: APP7_1312: Copper-responsive transcriptional regulator, MerR family |
|
*
Haemophilus parasuis SH0165 Site: position = -78 score = 4.4126 sequence = AGCCTAACCTTATGTTAGGGT Gene: HAPS_1832: Copper-responsive transcriptional regulator, MerR family |
Copper-responsive transcriptional regulator, MerR family |
| CRON 2. | ||||||||||
| COG3019 |
|
|
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -64 score = 4.96668 sequence = ACCTTAACCCTAGGTCAAGCT Gene: PM1939: putative metal-binding protein |
|
|
*
Haemophilus somnus 2336 Site: position = -66 score = 4.91788 sequence = ACCTTAACCCTAGGTTAAGCT Gene: HSM_1725: putative metal-binding protein |
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -71 score = 4.79492 sequence = ACCTTAACCTAGGGTTAAGGA Gene: APP7_1313: putative metal-binding protein |
|
|
putative metal-binding protein |
| copA0 |
*2
Haemophilus influenzae Rd KW20 Site: position = -63 score = 4.9694 sequence = ACCTTAACCTTATGTAAAGGT Gene: HI0292: truncated copper-transporting P-type ATPase Gene: HI0291: truncated copper-transporting P-type ATPase |
*
Aggregatibacter aphrophilus NJ8700 Site: position = -82 score = 5.19629 sequence = ACCTTAACCTAACGTTAAGGT Gene: NT05HA_0168: truncated copper-transporting P-type ATPase |
Gene: PM1891: truncated copper-transporting P-type ATPase |
*
Mannheimia succiniciproducens MBEL55E Site: position = -68 score = 5.79044 sequence = ACCTTCCCCTTAGGTCAAGGT Gene: MS0887: truncated copper-transporting P-type ATPase |
|
|
Gene: APP7_1314: truncated copper-transporting P-type ATPase |
|
|
truncated copper-transporting P-type ATPase |
| copA |
Gene: HI0290: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: NT05HA_0170: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: PM1892: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Gene: MS0888: Copper-translocating P-type ATPase (EC 3.6.3.4) |
*
Actinobacillus succinogenes 130Z Site: position = -28 score = 4.99954 sequence = ACTTTACCCTTACGTCAAGGT Gene: Asuc_1034: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
Gene: APP7_1315: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
Gene: HAPS_2154: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| NT05HA_0169 |
|
Gene: NT05HA_0169: hypothetical protein |
|
|
|
|
|
|
|
hypothetical protein |
| cueO |
|
|
Gene: PM1938: Multicopper oxidase |
|
|
Gene: HSM_1726: Multicopper oxidase |
|
|
|
Multicopper oxidase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |