Statistics of regulated genes

Genome	Genes	Operons
Haemophilus influenzae Rd KW20	4	2
Aggregatibacter aphrophilus NJ8700	4	2
Pasteurella multocida subsp. multocida str. Pm70	2	1
Mannheimia succiniciproducens MBEL55E	3	2
Actinobacillus succinogenes 130Z	2	2
Haemophilus somnus 2336	3	2
Actinobacillus pleuropneumoniae serovar 7 str. AP76	4	2
Haemophilus ducreyi 35000HP
Haemophilus parasuis SH0165	1	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes										Function
CRON 1.
cueR	* Haemophilus influenzae Rd KW20 Site: position = -34 score = 4.9694 sequence = ACCTTTACATAAGGTTAAGGT Gene: HI0293: Copper-responsive transcriptional regulator, MerR family	* Aggregatibacter aphrophilus NJ8700 Site: position = -33 score = 5.19629 sequence = ACCTTAACGTTAGGTTAAGGT Gene: NT05HA_0167: Copper-responsive transcriptional regulator, MerR family	Pasteurella multocida subsp. multocida str. Pm70	* Mannheimia succiniciproducens MBEL55E Site: position = -55 score = 5.79044 sequence = ACCTTGACCTAAGGGGAAGGT Gene: MS0886: Copper-responsive transcriptional regulator, MerR family	* Actinobacillus succinogenes 130Z Site: position = -63 score = 4.99954 sequence = ACCTTGACGTAAGGGTAAAGT Gene: Asuc_1033: Copper-responsive transcriptional regulator, MerR family	* Haemophilus somnus 2336 Site: position = -72 score = 4.40278 sequence = ACCTTGCGTTAGGGTCAAGGA Gene: HSM_1728: Copper-responsive transcriptional regulator, MerR family	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -35 score = 4.79492 sequence = TCCTTAACCCTAGGTTAAGGT Gene: APP7_1312: Copper-responsive transcriptional regulator, MerR family	Haemophilus ducreyi 35000HP	* Haemophilus parasuis SH0165 Site: position = -78 score = 4.4126 sequence = AGCCTAACCTTATGTTAGGGT Gene: HAPS_1832: Copper-responsive transcriptional regulator, MerR family	Copper-responsive transcriptional regulator, MerR family
CRON 2.
COG3019	Haemophilus influenzae Rd KW20	Aggregatibacter aphrophilus NJ8700	* Pasteurella multocida subsp. multocida str. Pm70 Site: position = -64 score = 4.96668 sequence = ACCTTAACCCTAGGTCAAGCT Gene: PM1939: putative metal-binding protein	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	* Haemophilus somnus 2336 Site: position = -66 score = 4.91788 sequence = ACCTTAACCCTAGGTTAAGCT Gene: HSM_1725: putative metal-binding protein	* Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -71 score = 4.79492 sequence = ACCTTAACCTAGGGTTAAGGA Gene: APP7_1313: putative metal-binding protein	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	putative metal-binding protein
copA0	*2 Haemophilus influenzae Rd KW20 Site: position = -63 score = 4.9694 sequence = ACCTTAACCTTATGTAAAGGT Gene: HI0292: truncated copper-transporting P-type ATPase Gene: HI0291: truncated copper-transporting P-type ATPase	* Aggregatibacter aphrophilus NJ8700 Site: position = -82 score = 5.19629 sequence = ACCTTAACCTAACGTTAAGGT Gene: NT05HA_0168: truncated copper-transporting P-type ATPase	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1891: truncated copper-transporting P-type ATPase	* Mannheimia succiniciproducens MBEL55E Site: position = -68 score = 5.79044 sequence = ACCTTCCCCTTAGGTCAAGGT Gene: MS0887: truncated copper-transporting P-type ATPase	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1314: truncated copper-transporting P-type ATPase	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	truncated copper-transporting P-type ATPase
copA	Haemophilus influenzae Rd KW20 Gene: HI0290: Copper-translocating P-type ATPase (EC 3.6.3.4)	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0170: Copper-translocating P-type ATPase (EC 3.6.3.4)	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1892: Copper-translocating P-type ATPase (EC 3.6.3.4)	Mannheimia succiniciproducens MBEL55E Gene: MS0888: Copper-translocating P-type ATPase (EC 3.6.3.4)	* Actinobacillus succinogenes 130Z Site: position = -28 score = 4.99954 sequence = ACTTTACCCTTACGTCAAGGT Gene: Asuc_1034: Copper-translocating P-type ATPase (EC 3.6.3.4)	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1315: Copper-translocating P-type ATPase (EC 3.6.3.4)	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165 Gene: HAPS_2154: Copper-translocating P-type ATPase (EC 3.6.3.4)	Copper-translocating P-type ATPase (EC 3.6.3.4)
NT05HA_0169	Haemophilus influenzae Rd KW20	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_0169: hypothetical protein	Pasteurella multocida subsp. multocida str. Pm70	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	hypothetical protein
cueO	Haemophilus influenzae Rd KW20	Aggregatibacter aphrophilus NJ8700	Pasteurella multocida subsp. multocida str. Pm70 Gene: PM1938: Multicopper oxidase	Mannheimia succiniciproducens MBEL55E	Actinobacillus succinogenes 130Z	Haemophilus somnus 2336 Gene: HSM_1726: Multicopper oxidase	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Haemophilus ducreyi 35000HP	Haemophilus parasuis SH0165	Multicopper oxidase

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD