Regulon of CueR in Pasteurella multocida subsp. multocida str. Pm70

Properties
Regulator type:	Transcription factor
TF locus tag:	PM1941
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Pasteurellales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5 Sequence: ACCTTAACCCTAGGTCAAGCT Locus tag: PM1939 Name: COG3019 Funciton: putative metal-binding protein Locus tag: PM1938 Name: cueO Funciton: Multicopper oxidase
	PM1939	COG3019	putative metal-binding protein
	PM1938	cueO	Multicopper oxidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD