Regulon of CueR in Actinobacillus succinogenes 130Z

Properties
Regulator type:	Transcription factor
TF locus tag:	Asuc_1033
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Pasteurellales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 5 Sequence: ACCTTGACGTAAGGGTAAAGT Locus tag: Asuc_1033 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	Asuc_1033	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -28 Score: 5 Sequence: ACTTTACCCTTACGTCAAGGT Locus tag: Asuc_1034 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Asuc_1034	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD