Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing NT05HA_0169 gene

Properties
Regulog: CueR - Pasteurellales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Phylum: Proteobacteria/gamma
Built upon 14 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Aggregatibacter aphrophilus NJ8700
Position: -82
Score: 5.19629
Sequence: ACCTTAACCTAACGTTAAGGT
Locus tag: NT05HA_0168
Name: copA0
Funciton: truncated copper-transporting P-type ATPase
Locus tag: NT05HA_0169
Name: null
Funciton: hypothetical protein
Locus tag: NT05HA_0170
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
copA0-NT05HA_0169-copA -82 5.2 ACCTTAACCTAACGTTAAGGT NT05HA_0168
© 2009-2020 RegPrecise