Regulon of CueR in Mannheimia succiniciproducens MBEL55E

Properties
Regulator type:	Transcription factor
TF locus tag:	MS0886
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Pasteurellales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 14 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 5.8 Sequence: ACCTTGACCTAAGGGGAAGGT Locus tag: MS0886 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	MS0886	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -68 Score: 5.8 Sequence: ACCTTCCCCTTAGGTCAAGGT Locus tag: MS0887 Name: copA0 Funciton: truncated copper-transporting P-type ATPase Locus tag: MS0888 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	MS0887	copA0	truncated copper-transporting P-type ATPase
	MS0888	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD