Regulog SoxR - Sphingomonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Sphingomonadales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Erythrobacter litoralis HTCC2594 | 1 | 1 |
| Erythrobacter sp. NAP1 | 1 | 1 |
| Novosphingobium aromaticivorans DSM 12444 | 2 | 1 |
| Sphingopyxis alaskensis RB2256 | 3 | 2 |
| Sphingobium japonicum UT26S | ||
| Sphingomonas wittichii RW1 | ||
| Zymomonas mobilis subsp. mobilis ZM4 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| PF00903 |
*
Erythrobacter litoralis HTCC2594 Site: position = -113 score = 6.24898 sequence = ACCTCAAGTCAGCTTGAGGT Gene: ELI_02955: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Erythrobacter sp. NAP1 Site: position = -26 score = 6.20633 sequence = ATCTCAAGTTAGGTTGAGGT Gene: NAP1_02240: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Novosphingobium aromaticivorans DSM 12444 Site: position = -72 score = 6.20862 sequence = ATCTCAAGCTAACTTGAGGT Gene: Saro_0953: Glyoxalase/bleomycin resistance protein/dioxygenase |
*
Sphingopyxis alaskensis RB2256 Site: position = -61 score = 4.44719 sequence = ATCTGAACCTCACTTCAGCT Gene: Sala_2166: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
|
|
Glyoxalase/bleomycin resistance protein/dioxygenase |
| nhoA |
|
|
Gene: Saro_0952: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
|
|
|
|
N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
| CRON 2. | ||||||||
| nhoA |
|
|
|
*
Sphingopyxis alaskensis RB2256 Site: position = -60 score = 5.32751 sequence = ACCTCCACTGCACTTGAGCT Gene: Sala_2373: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
|
Gene: Swit_4676: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
|
N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) |
| Sala_2372 |
|
|
|
Gene: Sala_2372: Sulfotransferase |
|
|
|
Sulfotransferase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |