Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nhoA gene

Properties
Regulog: SoxR - Sphingomonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/alpha
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Novosphingobium aromaticivorans DSM 12444
Position: -72
Score: 6.20862
Sequence: ATCTCAAGCTAACTTGAGGT
Locus tag: Saro_0953
Name: PF00903
Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
Locus tag: Saro_0952
Name: nhoA
Funciton: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
PF00903-nhoA -72 6.2 ATCTCAAGCTAACTTGAGGT Saro_0953
© 2009-2020 RegPrecise