Regulon of SoxR in Erythrobacter sp. NAP1

Properties
Regulator type:	Transcription factor
TF locus tag:	NAP1_02245
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Sphingomonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -26 Score: 6.2 Sequence: ATCTCAAGTTAGGTTGAGGT Locus tag: NAP1_02240 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	NAP1_02240	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD