Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nhoA gene

Properties
Regulog: SoxR - Sphingomonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/alpha
Built upon 5 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Sphingopyxis alaskensis RB2256
Position: -60
Score: 5.32751
Sequence: ACCTCCACTGCACTTGAGCT
Locus tag: Sala_2373
Name: nhoA
Funciton: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
Locus tag: Sala_2372
Name: null
Funciton: Sulfotransferase
nhoA-Sala_2372 -60 5.3 ACCTCCACTGCACTTGAGCT Sala_2373