Regulon of SoxR in Sphingopyxis alaskensis RB2256

Properties
Regulator type:	Transcription factor
TF locus tag:	Sala_2165
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Sphingomonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 4.4 Sequence: ATCTGAACCTCACTTCAGCT Locus tag: Sala_2166 Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase
	Sala_2166	PF00903	Glyoxalase/bleomycin resistance protein/dioxygenase
Position: -60 Score: 5.3 Sequence: ACCTCCACTGCACTTGAGCT Locus tag: Sala_2373 Name: nhoA Funciton: N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118) Locus tag: Sala_2372 Name: null Funciton: Sulfotransferase
	Sala_2373	nhoA	N-hydroxyarylamine O-acetyltransferase (EC 2.3.1.118)
	Sala_2372		Sulfotransferase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD