Regulog SoxR - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Statistics of regulated genes
Genome	Genes	Operons
Xylella fastidiosa 9a5c
Xanthomonas axonopodis pv. citri str. 306	3	3
Xanthomonas campestris pv. campestris str. ATCC 33913	2	2
Stenotrophomonas maltophilia K279a	10	5

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
soxR	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -27 score = 6.2064 sequence = GCCTCAACCTAAGTTGAGGT Gene: XAC3000: Redox-sensitive transcriptional activator, MerR family	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -27 score = 5.88988 sequence = GCCTCAACCAAGGTTGAGGT Gene: XCC2831: Redox-sensitive transcriptional activator, MerR family	* Stenotrophomonas maltophilia K279a Site: position = -26 score = 6.26083 sequence = ACCTCAACTGCAGTTGAGGT Gene: Smlt1084: Redox-sensitive transcriptional activator, MerR family	Redox-sensitive transcriptional activator, MerR family

CRON 2.
XAC0314	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -54 score = 6.11731 sequence = ACCTCAACTGCGCTTGAGGT Gene: XAC0314: Oxidative stress resistance protein	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -48 score = 5.86382 sequence = ACCTCAACCATGCTTTAGGT Gene: XCC0300: Oxidative stress resistance protein	Stenotrophomonas maltophilia K279a Gene: Smlt4414: Oxidative stress resistance protein	Oxidative stress resistance protein

CRON 3.
sodA	Xylella fastidiosa 9a5c Gene: XF2614: Manganese superoxide dismutase (EC 1.15.1.1)	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC2386: Manganese superoxide dismutase (EC 1.15.1.1)	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC2278: Manganese superoxide dismutase (EC 1.15.1.1)	2 Stenotrophomonas maltophilia K279a* Site: position = -76 score = 6.10475 sequence = ACCTCAACCAATGTTGAGGT Gene: Smlt2828: Manganese superoxide dismutase (EC 1.15.1.1) Gene: Smlt3238: Manganese superoxide dismutase (EC 1.15.1.1)	Manganese superoxide dismutase (EC 1.15.1.1)
PF01613	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2829: Putative flavin reductase	Putative flavin reductase
Smlt2830	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2830: Tetratricopeptide repeat protein	Tetratricopeptide repeat protein

CRON 4.
mexE	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC1482: RND transporter, membrane fusion protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC1439: RND transporter, membrane fusion protein	* Stenotrophomonas maltophilia K279a Site: position = -140 score = 5.83997 sequence = ACCTCGACCATGGTTGAGGT Gene: Smlt1830: RND transporter, membrane fusion protein	RND transporter, membrane fusion protein
mexF	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC1483: RND transporter, membrane fusion protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC1440: RND transporter, membrane fusion protein	Stenotrophomonas maltophilia K279a Gene: Smlt1831: RND transporter, membrane fusion protein	RND transporter, membrane fusion protein
PF00106	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC1484: oxidoreductase, short-chain dehydrogenase/reductase family	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC1441: oxidoreductase, short-chain dehydrogenase/reductase family	Stenotrophomonas maltophilia K279a Gene: Smlt1832: oxidoreductase, short-chain dehydrogenase/reductase family	oxidoreductase, short-chain dehydrogenase/reductase family
oprN	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC1485: RND transporter, outer membrane protein	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC1442: RND transporter, outer membrane protein	Stenotrophomonas maltophilia K279a Gene: Smlt1833: RND transporter, outer membrane protein	RND transporter, outer membrane protein

CRON 5.
PF01042	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -55 score = 5.80497 sequence = ACCTCAACCGGGGTTGAGGT Gene: Smlt2940: Endoribonuclease L-PSP	Endoribonuclease L-PSP

CRON 6.
PF07690	Xylella fastidiosa 9a5c	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -92 score = 6.2064 sequence = ACCTCAACTTAGGTTGAGGC Gene: XAC3001: Permease of the major facilitator superfamily	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -23 score = 6.26083 sequence = ACCTCAACTGCAGTTGAGGT Gene: Smlt1083: Permease of the major facilitator superfamily	Permease of the major facilitator superfamily

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SoxR - Xanthomonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --