Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing mexE gene

Properties
Regulog: SoxR - Xanthomonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Gamma
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -140
Score: 5.83997
Sequence: ACCTCGACCATGGTTGAGGT
Locus tag: Smlt1830
Name: mexE
Funciton: RND transporter, membrane fusion protein
Locus tag: Smlt1831
Name: mexF
Funciton: RND transporter, membrane fusion protein
Locus tag: Smlt1832
Name: PF00106
Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
Locus tag: Smlt1833
Name: oprN
Funciton: RND transporter, outer membrane protein
mexE-mexF-PF00106-oprN -140 5.8 ACCTCGACCATGGTTGAGGT Smlt1830