Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sodA gene

Properties
Regulog: SoxR - Xanthomonadales
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Superoxide stress response
Effector: Paraquat
Phylum: Proteobacteria/Gamma
Built upon 10 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Stenotrophomonas maltophilia K279a
Position: -76
Score: 6.10475
Sequence: ACCTCAACCAATGTTGAGGT
Locus tag: Smlt2828
Name: sodA
Funciton: Manganese superoxide dismutase (EC 1.15.1.1)
Locus tag: Smlt2829
Name: PF01613
Funciton: Putative flavin reductase
Locus tag: Smlt2830
Name: null
Funciton: Tetratricopeptide repeat protein
sodA-PF01613-Smlt2830 -76 6.1 ACCTCAACCAATGTTGAGGT Smlt2828