Regulon of SoxR in Stenotrophomonas maltophilia K279a

Properties
Regulator type:	Transcription factor
TF locus tag:	Smlt1084
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Xanthomonadales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -55 Score: 5.8 Sequence: ACCTCAACCGGGGTTGAGGT Locus tag: Smlt2940 Name: PF01042 Funciton: Endoribonuclease L-PSP
	Smlt2940	PF01042	Endoribonuclease L-PSP
Position: -140 Score: 5.8 Sequence: ACCTCGACCATGGTTGAGGT Locus tag: Smlt1830 Name: mexE Funciton: RND transporter, membrane fusion protein Locus tag: Smlt1831 Name: mexF Funciton: RND transporter, membrane fusion protein Locus tag: Smlt1832 Name: PF00106 Funciton: oxidoreductase, short-chain dehydrogenase/reductase family Locus tag: Smlt1833 Name: oprN Funciton: RND transporter, outer membrane protein
	Smlt1830	mexE	RND transporter, membrane fusion protein
	Smlt1831	mexF	RND transporter, membrane fusion protein
	Smlt1832	PF00106	oxidoreductase, short-chain dehydrogenase/reductase family
	Smlt1833	oprN	RND transporter, outer membrane protein
Position: -76 Score: 6.1 Sequence: ACCTCAACCAATGTTGAGGT Locus tag: Smlt2828 Name: sodA Funciton: Manganese superoxide dismutase (EC 1.15.1.1) Locus tag: Smlt2829 Name: PF01613 Funciton: Putative flavin reductase Locus tag: Smlt2830 Name: null Funciton: Tetratricopeptide repeat protein
	Smlt2828	sodA	Manganese superoxide dismutase (EC 1.15.1.1)
	Smlt2829	PF01613	Putative flavin reductase
	Smlt2830		Tetratricopeptide repeat protein
Position: -23 Score: 6.3 Sequence: ACCTCAACTGCAGTTGAGGT Locus tag: Smlt1083 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	Smlt1083	PF07690	Permease of the major facilitator superfamily
Position: -26 Score: 6.3 Sequence: ACCTCAACTGCAGTTGAGGT Locus tag: Smlt1084 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	Smlt1084	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD