Regulon of SoxR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type:	Transcription factor
TF locus tag:	XAC3000
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Xanthomonadales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 6.2 Sequence: ACCTCAACTTAGGTTGAGGC Locus tag: XAC3001 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	XAC3001	PF07690	Permease of the major facilitator superfamily
Position: -54 Score: 6.1 Sequence: ACCTCAACTGCGCTTGAGGT Locus tag: XAC0314 Name: null Funciton: Oxidative stress resistance protein
	XAC0314		Oxidative stress resistance protein
Position: -27 Score: 6.2 Sequence: GCCTCAACCTAAGTTGAGGT Locus tag: XAC3000 Name: soxR Funciton: Redox-sensitive transcriptional activator, MerR family
	XAC3000	soxR	Redox-sensitive transcriptional activator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD