Regulog NimR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Nickel homeostasis |
| Effector: | Nickel ion, (Ni2+) |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pasteurellales
- By TF family - MerR
- By effector - Nickel ion, (Ni2+)
- By pathway - Nickel homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||
| Actinobacillus succinogenes 130Z | 6 | 2 |
| Aggregatibacter aphrophilus NJ8700 | 5 | 1 |
| Haemophilus ducreyi 35000HP | ||
| Haemophilus influenzae Rd KW20 | 4 | 2 |
| Haemophilus parasuis SH0165 | ||
| Haemophilus somnus 2336 | ||
| Mannheimia succiniciproducens MBEL55E | 7 | 2 |
| Pasteurella multocida subsp. multocida str. Pm70 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| smtA |
|
|
|
|
|
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -60 score = 6.7025 sequence = ACCCTGAAGTTACTTCATAGT Gene: MS0467: ubiE/COQ5 methyltransferase |
|
ubiE/COQ5 methyltransferase |
| nikA |
|
|
|
|
|
|
|
Gene: MS0466: Nickel ABC transporter, periplasmic nickel-binding protein NikA (TC 3.A.1.5.3) |
|
Nickel ABC transporter, periplasmic nickel-binding protein NikA (TC 3.A.1.5.3) |
| nikB |
|
|
|
|
|
|
|
Gene: MS0465: Nickel transport system permease protein NikB (TC 3.A.1.5.3) |
|
Nickel transport system permease protein NikB (TC 3.A.1.5.3) |
| nikC |
|
|
|
|
|
|
|
Gene: MS0464: Nickel transport system permease protein NikC (TC 3.A.1.5.3) |
|
Nickel transport system permease protein NikC (TC 3.A.1.5.3) |
| nikD |
|
|
|
|
|
|
|
Gene: MS0463: Nickel transport ATP-binding protein NikD (TC 3.A.1.5.3) |
|
Nickel transport ATP-binding protein NikD (TC 3.A.1.5.3) |
| nikE |
|
|
|
|
|
|
|
Gene: MS0462: Nickel transport ATP-binding protein NikE (TC 3.A.1.5.3) |
|
Nickel transport ATP-binding protein NikE (TC 3.A.1.5.3) |
| CRON 2. | ||||||||||
| nikK |
Gene: APP7_1686: Additional periplasmic component NikK of nickel ECF transporter |
*
Actinobacillus succinogenes 130Z Site: position = -68 score = 6.65118 sequence = ACCCTGAAGTTACTTCATATT Gene: Asuc_0797: Additional periplasmic component NikK of nickel ECF transporter |
*
Aggregatibacter aphrophilus NJ8700 Site: position = -61 score = 6.03816 sequence = ACTCTAAAGTCGCTTCAGATT Gene: NT05HA_1176: Additional periplasmic component NikK of nickel ECF transporter |
|
*
Haemophilus influenzae Rd KW20 Site: position = -66 score = 6.41386 sequence = ATTCTAAAGTTACTTCATATT Gene: HI1624: Additional periplasmic component NikK of nickel ECF transporter |
|
|
|
|
Additional periplasmic component NikK of nickel ECF transporter |
| nikL |
Gene: APP7_1685: Additional component NikL of nickel ECF transporter |
Gene: Asuc_0796: Additional component NikL of nickel ECF transporter |
Gene: NT05HA_1175: Additional component NikL of nickel ECF transporter |
|
Gene: HI1622: Additional component NikL of nickel ECF transporter |
|
|
|
|
Additional component NikL of nickel ECF transporter |
| nikM |
Gene: APP7_1684: Substrate-specific component NikM of nickel ECF transporter |
Gene: Asuc_0795: Substrate-specific component NikM of nickel ECF transporter |
Gene: NT05HA_1174: Substrate-specific component NikM of nickel ECF transporter |
|
Gene: HI1621: Substrate-specific component NikM of nickel ECF transporter |
|
|
|
|
Substrate-specific component NikM of nickel ECF transporter |
| nikQ |
Gene: APP7_1683: Transmembrane component NikQ of energizing module of nickel ECF transporter |
Gene: Asuc_0794: Transmembrane component NikQ of energizing module of nickel ECF transporter |
Gene: NT05HA_1173: Transmembrane component NikQ of energizing module of nickel ECF transporter |
|
|
|
|
|
|
Transmembrane component NikQ of energizing module of nickel ECF transporter |
| nikO |
Gene: APP7_1682: ATPase component NikO of energizing module of nickel ECF transporter |
Gene: Asuc_0793: ATPase component NikO of energizing module of nickel ECF transporter |
Gene: NT05HA_1172: ATPase component NikO of energizing module of nickel ECF transporter |
|
Gene: HI1618: ATPase component NikO of energizing module of nickel ECF transporter |
|
|
|
|
ATPase component NikO of energizing module of nickel ECF transporter |
| CRON 3. | ||||||||||
| nimR |
|
*
Actinobacillus succinogenes 130Z Site: position = -71 score = 6.65118 sequence = AATATGAAGTAACTTCAGGGT Gene: Asuc_0798: Nickel-responsive transcriptional regulator, MerR family |
Gene: NT05HA_2207: Nickel-responsive transcriptional regulator, MerR family |
|
*
Haemophilus influenzae Rd KW20 Site: position = -44 score = 6.41386 sequence = AATATGAAGTAACTTTAGAAT Gene: HI1623: Nickel-responsive transcriptional regulator, MerR family |
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -55 score = 6.7025 sequence = ACTATGAAGTAACTTCAGGGT Gene: MS0468: Nickel-responsive transcriptional regulator, MerR family |
|
Nickel-responsive transcriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |