Regulog NimR - Pasteurellales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Phylum:	Proteobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By TF family - MerR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Actinobacillus pleuropneumoniae serovar 7 str. AP76
Actinobacillus succinogenes 130Z	6	2
Aggregatibacter aphrophilus NJ8700	5	1
Haemophilus ducreyi 35000HP
Haemophilus influenzae Rd KW20	4	2
Haemophilus parasuis SH0165
Haemophilus somnus 2336
Mannheimia succiniciproducens MBEL55E	7	2
Pasteurella multocida subsp. multocida str. Pm70

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
smtA	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336	* Mannheimia succiniciproducens MBEL55E Site: position = -60 score = 6.7025 sequence = ACCCTGAAGTTACTTCATAGT Gene: MS0467: ubiE/COQ5 methyltransferase	Pasteurella multocida subsp. multocida str. Pm70	ubiE/COQ5 methyltransferase
nikA	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E Gene: MS0466: Nickel ABC transporter, periplasmic nickel-binding protein NikA (TC 3.A.1.5.3)	Pasteurella multocida subsp. multocida str. Pm70	Nickel ABC transporter, periplasmic nickel-binding protein NikA (TC 3.A.1.5.3)
nikB	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E Gene: MS0465: Nickel transport system permease protein NikB (TC 3.A.1.5.3)	Pasteurella multocida subsp. multocida str. Pm70	Nickel transport system permease protein NikB (TC 3.A.1.5.3)
nikC	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E Gene: MS0464: Nickel transport system permease protein NikC (TC 3.A.1.5.3)	Pasteurella multocida subsp. multocida str. Pm70	Nickel transport system permease protein NikC (TC 3.A.1.5.3)
nikD	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E Gene: MS0463: Nickel transport ATP-binding protein NikD (TC 3.A.1.5.3)	Pasteurella multocida subsp. multocida str. Pm70	Nickel transport ATP-binding protein NikD (TC 3.A.1.5.3)
nikE	Actinobacillus pleuropneumoniae serovar 7 str. AP76	Actinobacillus succinogenes 130Z	Aggregatibacter aphrophilus NJ8700	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E Gene: MS0462: Nickel transport ATP-binding protein NikE (TC 3.A.1.5.3)	Pasteurella multocida subsp. multocida str. Pm70	Nickel transport ATP-binding protein NikE (TC 3.A.1.5.3)

CRON 2.
nikK	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1686: Additional periplasmic component NikK of nickel ECF transporter	* Actinobacillus succinogenes 130Z Site: position = -68 score = 6.65118 sequence = ACCCTGAAGTTACTTCATATT Gene: Asuc_0797: Additional periplasmic component NikK of nickel ECF transporter	* Aggregatibacter aphrophilus NJ8700 Site: position = -61 score = 6.03816 sequence = ACTCTAAAGTCGCTTCAGATT Gene: NT05HA_1176: Additional periplasmic component NikK of nickel ECF transporter	Haemophilus ducreyi 35000HP	* Haemophilus influenzae Rd KW20 Site: position = -66 score = 6.41386 sequence = ATTCTAAAGTTACTTCATATT Gene: HI1624: Additional periplasmic component NikK of nickel ECF transporter	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E	Pasteurella multocida subsp. multocida str. Pm70	Additional periplasmic component NikK of nickel ECF transporter
nikL	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1685: Additional component NikL of nickel ECF transporter	Actinobacillus succinogenes 130Z Gene: Asuc_0796: Additional component NikL of nickel ECF transporter	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1175: Additional component NikL of nickel ECF transporter	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20 Gene: HI1622: Additional component NikL of nickel ECF transporter	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E	Pasteurella multocida subsp. multocida str. Pm70	Additional component NikL of nickel ECF transporter
nikM	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1684: Substrate-specific component NikM of nickel ECF transporter	Actinobacillus succinogenes 130Z Gene: Asuc_0795: Substrate-specific component NikM of nickel ECF transporter	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1174: Substrate-specific component NikM of nickel ECF transporter	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20 Gene: HI1621: Substrate-specific component NikM of nickel ECF transporter	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E	Pasteurella multocida subsp. multocida str. Pm70	Substrate-specific component NikM of nickel ECF transporter
nikQ	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1683: Transmembrane component NikQ of energizing module of nickel ECF transporter	Actinobacillus succinogenes 130Z Gene: Asuc_0794: Transmembrane component NikQ of energizing module of nickel ECF transporter	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1173: Transmembrane component NikQ of energizing module of nickel ECF transporter	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E	Pasteurella multocida subsp. multocida str. Pm70	Transmembrane component NikQ of energizing module of nickel ECF transporter
nikO	Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_1682: ATPase component NikO of energizing module of nickel ECF transporter	Actinobacillus succinogenes 130Z Gene: Asuc_0793: ATPase component NikO of energizing module of nickel ECF transporter	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_1172: ATPase component NikO of energizing module of nickel ECF transporter	Haemophilus ducreyi 35000HP	Haemophilus influenzae Rd KW20 Gene: HI1618: ATPase component NikO of energizing module of nickel ECF transporter	Haemophilus parasuis SH0165	Haemophilus somnus 2336	Mannheimia succiniciproducens MBEL55E	Pasteurella multocida subsp. multocida str. Pm70	ATPase component NikO of energizing module of nickel ECF transporter

CRON 3.
nimR	Actinobacillus pleuropneumoniae serovar 7 str. AP76	* Actinobacillus succinogenes 130Z Site: position = -71 score = 6.65118 sequence = AATATGAAGTAACTTCAGGGT Gene: Asuc_0798: Nickel-responsive transcriptional regulator, MerR family	Aggregatibacter aphrophilus NJ8700 Gene: NT05HA_2207: Nickel-responsive transcriptional regulator, MerR family	Haemophilus ducreyi 35000HP	* Haemophilus influenzae Rd KW20 Site: position = -44 score = 6.41386 sequence = AATATGAAGTAACTTTAGAAT Gene: HI1623: Nickel-responsive transcriptional regulator, MerR family	Haemophilus parasuis SH0165	Haemophilus somnus 2336	* Mannheimia succiniciproducens MBEL55E Site: position = -55 score = 6.7025 sequence = ACTATGAAGTAACTTCAGGGT Gene: MS0468: Nickel-responsive transcriptional regulator, MerR family	Pasteurella multocida subsp. multocida str. Pm70	Nickel-responsive transcriptional regulator, MerR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NimR - Pasteurellales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --