Regulon of NimR in Mannheimia succiniciproducens MBEL55E

Properties
Regulator type:	Transcription factor
TF locus tag:	MS0468
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NimR - Pasteurellales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By TF family - MerR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.7 Sequence: ACCCTGAAGTTACTTCATAGT Locus tag: MS0467 Name: smtA Funciton: ubiE/COQ5 methyltransferase Locus tag: MS0466 Name: nikA Funciton: Nickel ABC transporter, periplasmic nickel-binding protein NikA (TC 3.A.1.5.3) Locus tag: MS0465 Name: nikB Funciton: Nickel transport system permease protein NikB (TC 3.A.1.5.3) Locus tag: MS0464 Name: nikC Funciton: Nickel transport system permease protein NikC (TC 3.A.1.5.3) Locus tag: MS0463 Name: nikD Funciton: Nickel transport ATP-binding protein NikD (TC 3.A.1.5.3) Locus tag: MS0462 Name: nikE Funciton: Nickel transport ATP-binding protein NikE (TC 3.A.1.5.3)
	MS0467	smtA	ubiE/COQ5 methyltransferase
	MS0466	nikA	Nickel ABC transporter, periplasmic nickel-binding protein NikA (TC 3.A.1.5.3)
	MS0465	nikB	Nickel transport system permease protein NikB (TC 3.A.1.5.3)
	MS0464	nikC	Nickel transport system permease protein NikC (TC 3.A.1.5.3)
	MS0463	nikD	Nickel transport ATP-binding protein NikD (TC 3.A.1.5.3)
	MS0462	nikE	Nickel transport ATP-binding protein NikE (TC 3.A.1.5.3)
Position: -55 Score: 6.7 Sequence: ACTATGAAGTAACTTCAGGGT Locus tag: MS0468 Name: nimR Funciton: Nickel-responsive transcriptional regulator, MerR family
	MS0468	nimR	Nickel-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD