Regulon of NimR in Haemophilus influenzae Rd KW20

Properties
Regulator type:	Transcription factor
TF locus tag:	HI1623
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NimR - Pasteurellales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By TF family - MerR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.4 Sequence: ATTCTAAAGTTACTTCATATT Locus tag: HI1624 Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter Locus tag: HI1622 Name: nikL Funciton: Additional component NikL of nickel ECF transporter Locus tag: HI1621 Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter
	HI1624	nikK	Additional periplasmic component NikK of nickel ECF transporter
	HI1622	nikL	Additional component NikL of nickel ECF transporter
	HI1621	nikM	Substrate-specific component NikM of nickel ECF transporter
Position: -44 Score: 6.4 Sequence: AATATGAAGTAACTTTAGAAT Locus tag: HI1623 Name: nimR Funciton: Nickel-responsive transcriptional regulator, MerR family
	HI1623	nimR	Nickel-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD