Regulon of NimR in Actinobacillus succinogenes 130Z

Properties
Regulator type:	Transcription factor
TF locus tag:	Asuc_0798
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NimR - Pasteurellales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By TF family - MerR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -68 Score: 6.7 Sequence: ACCCTGAAGTTACTTCATATT Locus tag: Asuc_0797 Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter Locus tag: Asuc_0796 Name: nikL Funciton: Additional component NikL of nickel ECF transporter Locus tag: Asuc_0795 Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter Locus tag: Asuc_0794 Name: nikQ Funciton: Transmembrane component NikQ of energizing module of nickel ECF transporter Locus tag: Asuc_0793 Name: nikO Funciton: ATPase component NikO of energizing module of nickel ECF transporter
	Asuc_0797	nikK	Additional periplasmic component NikK of nickel ECF transporter
	Asuc_0796	nikL	Additional component NikL of nickel ECF transporter
	Asuc_0795	nikM	Substrate-specific component NikM of nickel ECF transporter
	Asuc_0794	nikQ	Transmembrane component NikQ of energizing module of nickel ECF transporter
	Asuc_0793	nikO	ATPase component NikO of energizing module of nickel ECF transporter
Position: -71 Score: 6.7 Sequence: AATATGAAGTAACTTCAGGGT Locus tag: Asuc_0798 Name: nimR Funciton: Nickel-responsive transcriptional regulator, MerR family
	Asuc_0798	nimR	Nickel-responsive transcriptional regulator, MerR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD