Regulon of NimR in Aggregatibacter aphrophilus NJ8700

Properties
Regulator type:	Transcription factor
TF locus tag:	NT05HA_2207
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Nickel homeostasis
Effector:	Nickel ion, (Ni2+)
Regulog:	NimR - Pasteurellales
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By TF family - MerR
By effector - Nickel ion, (Ni2+)
By pathway - Nickel homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6 Sequence: ACTCTAAAGTCGCTTCAGATT Locus tag: NT05HA_1176 Name: nikK Funciton: Additional periplasmic component NikK of nickel ECF transporter Locus tag: NT05HA_1175 Name: nikL Funciton: Additional component NikL of nickel ECF transporter Locus tag: NT05HA_1174 Name: nikM Funciton: Substrate-specific component NikM of nickel ECF transporter Locus tag: NT05HA_1173 Name: nikQ Funciton: Transmembrane component NikQ of energizing module of nickel ECF transporter Locus tag: NT05HA_1172 Name: nikO Funciton: ATPase component NikO of energizing module of nickel ECF transporter
	NT05HA_1176	nikK	Additional periplasmic component NikK of nickel ECF transporter
	NT05HA_1175	nikL	Additional component NikL of nickel ECF transporter
	NT05HA_1174	nikM	Substrate-specific component NikM of nickel ECF transporter
	NT05HA_1173	nikQ	Transmembrane component NikQ of energizing module of nickel ECF transporter
	NT05HA_1172	nikO	ATPase component NikO of energizing module of nickel ECF transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD