Regulog ThuR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Trehalose utilization |
| Effector: | Trehalose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Trehalose
- By pathway - Trehalose utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 7 | 2 |
| Sinorhizobium meliloti 1021 | 7 | 2 |
| Rhizobium sp. NGR234 | 7 | 2 |
| Rhizobium etli CFN 42 | 9 | 3 |
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Azorhizobium caulinodans ORS 571 | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Brucella melitensis 16M | 9 | 2 |
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| thuE |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -210 score = 6.58951 sequence = AATTGAAAACGATTTCAATT Site: position = -58 score = 5.00467 sequence = AGTCAAAAGCGCTTTCAATT Gene: Atu3338: Putative trehalose ABC transporter, substrate-binding protein |
*
Sinorhizobium meliloti 1021 Site: position = -258 score = 5.99126 sequence = GATCCAAATCGTTTTAAATT Site: position = -63 score = 4.89171 sequence = TACCCAAACCGTTTTCGAAT Gene: SMb20325: Putative trehalose ABC transporter, substrate-binding protein |
*
Rhizobium sp. NGR234 Site: position = -252 score = 5.16714 sequence = TAGCCCAATCGTTTTAAATT Site: position = -68 score = 5.09886 sequence = CAGCCAAACCGTTTTCGAAT Gene: NGR_b23140: Putative trehalose ABC transporter, substrate-binding protein |
*
Rhizobium etli CFN 42 Site: position = -194 score = 6.68579 sequence = AATTGAAATCGATTTCAATT Site: position = -34 score = 5.62053 sequence = TGTCCAAATCGATTTCAATT Gene: RHE_PF00210: Putative trehalose ABC transporter, substrate-binding protein |
Gene: pRL120035: Putative trehalose ABC transporter, substrate-binding protein |
|
|
|
*
Brucella melitensis 16M Site: position = -244 score = 5.84854 sequence = AATCCAAACCGCTTTCAATC Site: position = -75 score = 5.24342 sequence = TACCCAAACCGTTTTCGATT Gene: BMEII0945: Putative trehalose ABC transporter, substrate-binding protein |
|
|
|
|
|
|
Putative trehalose ABC transporter, substrate-binding protein |
| thuF |
Gene: Atu3339: Putative trehalose ABC transporter, inner membrane protein |
Gene: SMb20326: Putative trehalose ABC transporter, inner membrane protein |
Gene: NGR_b23130: Putative trehalose ABC transporter, inner membrane protein |
Gene: RHE_PF00209: Putative trehalose ABC transporter, inner membrane protein |
Gene: pRL120036: Putative trehalose ABC transporter, inner membrane protein |
|
|
|
2
Brucella melitensis 16M Gene: BMEII0944: Putative trehalose ABC transporter, inner membrane protein Gene: BMEII0943: Putative trehalose ABC transporter, inner membrane protein |
|
|
|
|
|
|
Putative trehalose ABC transporter, inner membrane protein |
| thuG |
Gene: Atu3340: Putative trehalose ABC transporter, inner membrane protein |
Gene: SMb20327: Putative trehalose ABC transporter, inner membrane protein |
Gene: NGR_b23120: Putative trehalose ABC transporter, inner membrane protein |
Gene: RHE_PF00208: Putative trehalose ABC transporter, inner membrane protein |
Gene: pRL120037: Putative trehalose ABC transporter, inner membrane protein |
|
|
|
Gene: BMEII0942: Putative trehalose ABC transporter, inner membrane protein |
|
|
|
|
|
|
Putative trehalose ABC transporter, inner membrane protein |
| thuK |
Gene: Atu3341: Putative trehalose ABC transporter, ATP-binding protein |
Gene: SMb20328: Putative trehalose ABC transporter, ATP-binding protein |
Gene: NGR_b23110: Putative trehalose ABC transporter, ATP-binding protein |
Gene: RHE_PF00207: Putative trehalose ABC transporter, ATP-binding protein |
Gene: pRL120038: Putative trehalose ABC transporter, ATP-binding protein |
|
|
|
2
Brucella melitensis 16M Gene: BMEII0941: Putative trehalose ABC transporter, ATP-binding protein Gene: BMEII0940: Putative trehalose ABC transporter, ATP-binding protein |
|
|
|
|
|
|
Putative trehalose ABC transporter, ATP-binding protein |
| thuA |
Gene: Atu3342: Trehalose utilization protein ThuA |
Gene: SMb20329: Trehalose utilization protein ThuA |
Gene: NGR_b23100: Trehalose utilization protein ThuA |
Gene: RHE_PF00206: Trehalose utilization protein ThuA |
Gene: pRL120039: Trehalose utilization protein ThuA |
|
|
|
Gene: BMEII0939: Trehalose utilization protein ThuA |
|
|
|
|
|
|
Trehalose utilization protein ThuA |
| thuB |
Gene: Atu3343: Trehalose utilization oxidoreductase protein ThuB |
Gene: SMb20330: Trehalose utilization oxidoreductase protein ThuB |
Gene: NGR_b23090: Trehalose utilization oxidoreductase protein ThuB |
Gene: RHE_PF00205: Trehalose utilization oxidoreductase protein ThuB |
Gene: pRL120040: Trehalose utilization oxidoreductase protein ThuB |
|
|
|
Gene: BMEII0938: Trehalose utilization oxidoreductase protein ThuB |
|
|
|
|
|
|
Trehalose utilization oxidoreductase protein ThuB |
| CRON 2. | ||||||||||||||||
| thuR |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -78 score = 6.58951 sequence = AATTGAAATCGTTTTCAATT Site: position = -230 score = 5.00467 sequence = AATTGAAAGCGCTTTTGACT Gene: Atu3337: Putative trehalose utilization regulator ThuR, LacI family |
*
Sinorhizobium meliloti 1021 Site: position = -240 score = 5.99126 sequence = AATTTAAAACGATTTGGATC Gene: SMb20324: Putative trehalose utilization regulator ThuR, LacI family |
*
Rhizobium sp. NGR234 Site: position = -141 score = 5.16714 sequence = AATTTAAAACGATTGGGCTA Gene: NGR_b23150: Putative trehalose utilization regulator ThuR, LacI family |
*
Rhizobium etli CFN 42 Site: position = -257 score = 5.62053 sequence = AATTGAAATCGATTTGGACA Site: position = -97 score = 6.68579 sequence = AATTGAAATCGATTTCAATT Gene: RHE_PF00211: Putative trehalose utilization regulator ThuR, LacI family |
|
|
|
|
*
Brucella melitensis 16M Site: position = -126 score = 5.84854 sequence = GATTGAAAGCGGTTTGGATT Gene: BMEII0946: Putative trehalose utilization regulator ThuR, LacI family |
|
|
|
|
|
|
Putative trehalose utilization regulator ThuR, LacI family |
| CRON 3. | ||||||||||||||||
| thuA2 |
|
|
|
*
Rhizobium etli CFN 42 Site: position = -67 score = 5.6844 sequence = TTTCCAAAGCGCTTTGAATT Gene: RHE_CH03256: Trehalose utilization protein ThuA |
|
|
|
|
|
|
|
|
|
|
|
Trehalose utilization protein ThuA |
| thuB2 |
|
|
|
Gene: RHE_CH03255: Trehalose utilization oxidoreductase protein ThuB |
|
|
|
|
|
|
|
|
|
|
|
Trehalose utilization oxidoreductase protein ThuB |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |