Regulon of ThuR in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_b23150
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	ThuR - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -141 Score: 5.2 Sequence: AATTTAAAACGATTGGGCTA Locus tag: NGR_b23150 Name: thuR Funciton: Putative trehalose utilization regulator ThuR, LacI family
	NGR_b23150	thuR	Putative trehalose utilization regulator ThuR, LacI family
Position: -252 Score: 5.2 Sequence: TAGCCCAATCGTTTTAAATT Position: -68 Score: 5.1 Sequence: CAGCCAAACCGTTTTCGAAT Locus tag: NGR_b23140 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: NGR_b23130 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: NGR_b23120 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: NGR_b23110 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: NGR_b23100 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: NGR_b23090 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
	NGR_b23140	thuE	Putative trehalose ABC transporter, substrate-binding protein
	NGR_b23130	thuF	Putative trehalose ABC transporter, inner membrane protein
	NGR_b23120	thuG	Putative trehalose ABC transporter, inner membrane protein
	NGR_b23110	thuK	Putative trehalose ABC transporter, ATP-binding protein
	NGR_b23100	thuA	Trehalose utilization protein ThuA
	NGR_b23090	thuB	Trehalose utilization oxidoreductase protein ThuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD