Orthologous regulated operons containing thuK gene

Properties
Regulog:	ThuR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Phylum:	Proteobacteria/Alpha

Built upon 18 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -210 Score: 6.58951 Sequence: AATTGAAAACGATTTCAATT Position: -58 Score: 5.00467 Sequence: AGTCAAAAGCGCTTTCAATT Locus tag: Atu3338 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: Atu3339 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: Atu3340 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: Atu3341 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: Atu3342 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: Atu3343 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
thuE-thuF-thuG-thuK-thuA-thuB	-210	6.6	AATTGAAAACGATTTCAATT	Atu3338
	-58	5	AGTCAAAAGCGCTTTCAATT
Brucella melitensis 16M
Position: -244 Score: 5.84854 Sequence: AATCCAAACCGCTTTCAATC Position: -75 Score: 5.24342 Sequence: TACCCAAACCGTTTTCGATT Locus tag: BMEII0945 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: BMEII0944 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: BMEII0943 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: BMEII0942 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: BMEII0941 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: BMEII0940 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: BMEII0939 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: BMEII0938 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
thuE-thuF-thuF-thuG-thuK-thuK-thuA-thuB	-244	5.8	AATCCAAACCGCTTTCAATC	BMEII0945
	-75	5.2	TACCCAAACCGTTTTCGATT
Rhizobium etli CFN 42
Position: -194 Score: 6.68579 Sequence: AATTGAAATCGATTTCAATT Position: -34 Score: 5.62053 Sequence: TGTCCAAATCGATTTCAATT Locus tag: RHE_PF00210 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: RHE_PF00209 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: RHE_PF00208 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: RHE_PF00207 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: RHE_PF00206 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: RHE_PF00205 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
thuE-thuF-thuG-thuK-thuA-thuB	-194	6.7	AATTGAAATCGATTTCAATT	RHE_PF00210
	-34	5.6	TGTCCAAATCGATTTCAATT
Rhizobium sp. NGR234
Position: -252 Score: 5.16714 Sequence: TAGCCCAATCGTTTTAAATT Position: -68 Score: 5.09886 Sequence: CAGCCAAACCGTTTTCGAAT Locus tag: NGR_b23140 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: NGR_b23130 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: NGR_b23120 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: NGR_b23110 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: NGR_b23100 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: NGR_b23090 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
thuE-thuF-thuG-thuK-thuA-thuB	-252	5.2	TAGCCCAATCGTTTTAAATT	NGR_b23140
	-68	5.1	CAGCCAAACCGTTTTCGAAT
Sinorhizobium meliloti 1021
Position: -258 Score: 5.99126 Sequence: GATCCAAATCGTTTTAAATT Position: -63 Score: 4.89171 Sequence: TACCCAAACCGTTTTCGAAT Locus tag: SMb20325 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: SMb20326 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: SMb20327 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: SMb20328 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: SMb20329 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: SMb20330 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
thuE-thuF-thuG-thuK-thuA-thuB	-258	6	GATCCAAATCGTTTTAAATT	SMb20325
	-63	4.9	TACCCAAACCGTTTTCGAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing thuK gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --