Regulon of ThuR in Brucella melitensis 16M

Properties
Regulator type:	Transcription factor
TF locus tag:	BMEII0946
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	ThuR - Rhizobiales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -126 Score: 5.8 Sequence: GATTGAAAGCGGTTTGGATT Locus tag: BMEII0946 Name: thuR Funciton: Putative trehalose utilization regulator ThuR, LacI family
	BMEII0946	thuR	Putative trehalose utilization regulator ThuR, LacI family
Position: -244 Score: 5.8 Sequence: AATCCAAACCGCTTTCAATC Position: -75 Score: 5.2 Sequence: TACCCAAACCGTTTTCGATT Locus tag: BMEII0945 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: BMEII0944 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: BMEII0943 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: BMEII0942 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: BMEII0941 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: BMEII0940 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: BMEII0939 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: BMEII0938 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
	BMEII0945	thuE	Putative trehalose ABC transporter, substrate-binding protein
	BMEII0944	thuF	Putative trehalose ABC transporter, inner membrane protein
	BMEII0943	thuF	Putative trehalose ABC transporter, inner membrane protein
	BMEII0942	thuG	Putative trehalose ABC transporter, inner membrane protein
	BMEII0941	thuK	Putative trehalose ABC transporter, ATP-binding protein
	BMEII0940	thuK	Putative trehalose ABC transporter, ATP-binding protein
	BMEII0939	thuA	Trehalose utilization protein ThuA
	BMEII0938	thuB	Trehalose utilization oxidoreductase protein ThuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD