Regulon of ThuR in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu3337
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	ThuR - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -230 Score: 5 Sequence: AATTGAAAGCGCTTTTGACT Position: -78 Score: 6.6 Sequence: AATTGAAATCGTTTTCAATT Locus tag: Atu3337 Name: thuR Funciton: Putative trehalose utilization regulator ThuR, LacI family
	Atu3337	thuR	Putative trehalose utilization regulator ThuR, LacI family
Position: -210 Score: 6.6 Sequence: AATTGAAAACGATTTCAATT Position: -58 Score: 5 Sequence: AGTCAAAAGCGCTTTCAATT Locus tag: Atu3338 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: Atu3339 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: Atu3340 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: Atu3341 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: Atu3342 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: Atu3343 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
	Atu3338	thuE	Putative trehalose ABC transporter, substrate-binding protein
	Atu3339	thuF	Putative trehalose ABC transporter, inner membrane protein
	Atu3340	thuG	Putative trehalose ABC transporter, inner membrane protein
	Atu3341	thuK	Putative trehalose ABC transporter, ATP-binding protein
	Atu3342	thuA	Trehalose utilization protein ThuA
	Atu3343	thuB	Trehalose utilization oxidoreductase protein ThuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD