Regulon of ThuR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb20324
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Trehalose utilization
Effector:	Trehalose
Regulog:	ThuR - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 18 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Trehalose
By pathway - Trehalose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -240 Score: 6 Sequence: AATTTAAAACGATTTGGATC Locus tag: SMb20324 Name: thuR Funciton: Putative trehalose utilization regulator ThuR, LacI family
	SMb20324	thuR	Putative trehalose utilization regulator ThuR, LacI family
Position: -258 Score: 6 Sequence: GATCCAAATCGTTTTAAATT Position: -63 Score: 4.9 Sequence: TACCCAAACCGTTTTCGAAT Locus tag: SMb20325 Name: thuE Funciton: Putative trehalose ABC transporter, substrate-binding protein Locus tag: SMb20326 Name: thuF Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: SMb20327 Name: thuG Funciton: Putative trehalose ABC transporter, inner membrane protein Locus tag: SMb20328 Name: thuK Funciton: Putative trehalose ABC transporter, ATP-binding protein Locus tag: SMb20329 Name: thuA Funciton: Trehalose utilization protein ThuA Locus tag: SMb20330 Name: thuB Funciton: Trehalose utilization oxidoreductase protein ThuB
	SMb20325	thuE	Putative trehalose ABC transporter, substrate-binding protein
	SMb20326	thuF	Putative trehalose ABC transporter, inner membrane protein
	SMb20327	thuG	Putative trehalose ABC transporter, inner membrane protein
	SMb20328	thuK	Putative trehalose ABC transporter, ATP-binding protein
	SMb20329	thuA	Trehalose utilization protein ThuA
	SMb20330	thuB	Trehalose utilization oxidoreductase protein ThuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD