Regulog LsrR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | SorC |
| Regulation mode: | repressor |
| Biological process: | Quorum sensing; Biofilm formation |
| Effector: | 4,5-dihydroxypentan-2,3-dione |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - SorC
- By effector - 4,5-dihydroxypentan-2,3-dione
- By pathway - Quorum sensing
- By pathway - Biofilm formation
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | 8 | 2 |
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | 8 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 8 | 2 |
| Photorhabdus luminescens subsp. laumondii TTO1 | 8 | 2 |
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | 8 | 2 |
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM | 6 | 1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| lsrR |
|
|
*
Enterobacter sp. 638 Site: position = -35 score = 6.01979 sequence = GAACATATGATCTAAATTTTTATAAGAGTTC Site: position = -201 score = 6.63222 sequence = GAACAAATGATTTTTTGATTTAATAATGTTC Gene: Ent638_3537: Quorum sensing transcriptional repgulator of LsrR, SorC family |
|
|
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -48 score = 6.67963 sequence = GAACAATTGCATTAAAGATTTAAATATGTTC Site: position = -216 score = 6.5782 sequence = GAACAAATGTATTTCTGCTTTTAATTTGTTC Gene: b1512: Quorum sensing transcriptional repgulator of LsrR, SorC family |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -36 score = 6.01979 sequence = GAACATATGATCTAAATTTTTATAAGAGTTC Site: position = -203 score = 6.6899 sequence = GAACAAATGATTTTTAAATTTAATAATGTTC Gene: KPN_03508: Quorum sensing transcriptional repgulator of LsrR, SorC family |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -184 score = 6.77146 sequence = GAACATTTATCTATTTAAAAAACAATTGTTC Gene: plu3142: Quorum sensing transcriptional repgulator of LsrR, SorC family |
|
*
Salmonella typhimurium LT2 Site: position = -219 score = 6.62558 sequence = GAACAAATGTTTTTTGAAAAAGAAATTGTTC Site: position = -53 score = 6.47538 sequence = GAACAATTGTGTTAATGATTTAGAAATGTTC Gene: STM4073: Quorum sensing transcriptional repgulator of LsrR, SorC family |
|
2
Yersinia pestis KIM Gene: y3766: Quorum sensing transcriptional repgulator of LsrR, SorC family Gene: y3765: Quorum sensing transcriptional repgulator of LsrR, SorC family |
Quorum sensing transcriptional repgulator of LsrR, SorC family |
| lsrK |
|
|
Gene: Ent638_3538: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-) |
|
|
Gene: b1511: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-) |
Gene: KPN_03509: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-) |
Gene: plu3141: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-) |
|
Gene: STM4072: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-) |
|
Gene: y3764: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-) |
Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-) |
| CRON 2. | |||||||||||||
| lsrA |
|
|
*
Enterobacter sp. 638 Site: position = -46 score = 6.63222 sequence = GAACATTATTAAATCAAAAAATCATTTGTTC Site: position = -212 score = 6.01979 sequence = GAACTCTTATAAAAATTTAGATCATATGTTC Gene: Ent638_3536: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component |
|
|
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -63 score = 6.5782 sequence = GAACAAATTAAAAGCAGAAATACATTTGTTC Site: position = -231 score = 6.67963 sequence = GAACATATTTAAATCTTTAATGCAATTGTTC Gene: b1513: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component |
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -210 score = 6.01979 sequence = GAACTCTTATAAAAATTTAGATCATATGTTC Site: position = -43 score = 6.6899 sequence = GAACATTATTAAATTTAAAAATCATTTGTTC Gene: KPN_03507: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component |
*
Photorhabdus luminescens subsp. laumondii TTO1 Site: position = -72 score = 6.77146 sequence = GAACAATTGTTTTTTAAATAGATAAATGTTC Gene: plu3143: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component |
|
*
Salmonella typhimurium LT2 Site: position = -233 score = 6.47538 sequence = GAACATTTCTAAATCATTAACACAATTGTTC Site: position = -67 score = 6.62558 sequence = GAACAATTTCTTTTTCAAAAAACATTTGTTC Gene: STM4074: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component |
|
*
Yersinia pestis KIM Site: position = 2 score = 6.60668 sequence = GAACACTTTTAAATTAAAAATATTTTTGTTC Gene: y3769: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component |
Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component |
| lsrC |
|
|
Gene: Ent638_3535: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC |
|
|
Gene: b1514: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC |
Gene: KPN_03506: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC |
Gene: plu3144: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC |
|
Gene: STM4075: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC |
|
Gene: y3770: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC |
Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC |
| lsrD |
|
|
Gene: Ent638_3534: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD |
|
|
Gene: b1515: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD |
Gene: KPN_03505: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD |
Gene: plu3145: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD |
|
Gene: STM4076: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD |
|
Gene: y3771: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD |
Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD |
| lsrB |
|
|
Gene: Ent638_3533: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB |
|
|
Gene: b1516: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB |
Gene: KPN_03504: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB |
Gene: plu3146: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB |
|
Gene: STM4077: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB |
|
Gene: y3772: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB |
Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB |
| lsrF |
|
|
Gene: Ent638_3532: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) |
|
|
Gene: b1517: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) |
Gene: KPN_03503: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) |
Gene: plu3147: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) |
|
Gene: STM4078: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) |
|
Gene: y3773: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) |
Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) |
| lsrG |
|
|
Gene: Ent638_3531: Autoinducer 2 (AI-2) modifying protein LsrG |
|
|
Gene: b1518: Autoinducer 2 (AI-2) modifying protein LsrG |
Gene: KPN_03502: Autoinducer 2 (AI-2) modifying protein LsrG |
Gene: plu3148: Autoinducer 2 (AI-2) modifying protein LsrG |
|
Gene: STM4079.S: Autoinducer 2 (AI-2) modifying protein LsrG |
|
Gene: y3774: Autoinducer 2 (AI-2) modifying protein LsrG |
Autoinducer 2 (AI-2) modifying protein LsrG |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |