Regulon of LsrR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y3765
Regulator family:	SorC
Regulation mode:	repressor
Biological process:	Quorum sensing; Biofilm formation
Effector:	4,5-dihydroxypentan-2,3-dione
Regulog:	LsrR - Enterobacteriales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - SorC
By effector - 4,5-dihydroxypentan-2,3-dione
By pathway - Quorum sensing
By pathway - Biofilm formation

Regulated operons
	Locus Tag	Name	Function
Position: 2 Score: 6.6 Sequence: GAACACTTTTAAATTAAAAATATTTTTGTTC Locus tag: y3769 Name: lsrA Funciton: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component Locus tag: y3770 Name: lsrC Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC Locus tag: y3771 Name: lsrD Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD Locus tag: y3772 Name: lsrB Funciton: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB Locus tag: y3773 Name: lsrF Funciton: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) Locus tag: y3774 Name: lsrG Funciton: Autoinducer 2 (AI-2) modifying protein LsrG
	y3769	lsrA	Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component
	y3770	lsrC	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC
	y3771	lsrD	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD
	y3772	lsrB	Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB
	y3773	lsrF	Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-)
	y3774	lsrG	Autoinducer 2 (AI-2) modifying protein LsrG

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD