Regulon of LsrR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_03508
Regulator family:	SorC
Regulation mode:	repressor
Biological process:	Quorum sensing; Biofilm formation
Effector:	4,5-dihydroxypentan-2,3-dione
Regulog:	LsrR - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - SorC
By effector - 4,5-dihydroxypentan-2,3-dione
By pathway - Quorum sensing
By pathway - Biofilm formation

Regulated operons
	Locus Tag	Name	Function
Position: -210 Score: 6 Sequence: GAACTCTTATAAAAATTTAGATCATATGTTC Position: -43 Score: 6.7 Sequence: GAACATTATTAAATTTAAAAATCATTTGTTC Locus tag: KPN_03507 Name: lsrA Funciton: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component Locus tag: KPN_03506 Name: lsrC Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC Locus tag: KPN_03505 Name: lsrD Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD Locus tag: KPN_03504 Name: lsrB Funciton: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB Locus tag: KPN_03503 Name: lsrF Funciton: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) Locus tag: KPN_03502 Name: lsrG Funciton: Autoinducer 2 (AI-2) modifying protein LsrG
	KPN_03507	lsrA	Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component
	KPN_03506	lsrC	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC
	KPN_03505	lsrD	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD
	KPN_03504	lsrB	Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB
	KPN_03503	lsrF	Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-)
	KPN_03502	lsrG	Autoinducer 2 (AI-2) modifying protein LsrG
Position: -203 Score: 6.7 Sequence: GAACAAATGATTTTTAAATTTAATAATGTTC Position: -36 Score: 6 Sequence: GAACATATGATCTAAATTTTTATAAGAGTTC Locus tag: KPN_03508 Name: lsrR Funciton: Quorum sensing transcriptional repgulator of LsrR, SorC family Locus tag: KPN_03509 Name: lsrK Funciton: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)
	KPN_03508	lsrR	Quorum sensing transcriptional repgulator of LsrR, SorC family
	KPN_03509	lsrK	Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD