Regulon of LsrR in Photorhabdus luminescens subsp. laumondii TTO1

Properties
Regulator type:	Transcription factor
TF locus tag:	plu3142
Regulator family:	SorC
Regulation mode:	repressor
Biological process:	Quorum sensing; Biofilm formation
Effector:	4,5-dihydroxypentan-2,3-dione
Regulog:	LsrR - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - SorC
By effector - 4,5-dihydroxypentan-2,3-dione
By pathway - Quorum sensing
By pathway - Biofilm formation

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.8 Sequence: GAACAATTGTTTTTTAAATAGATAAATGTTC Locus tag: plu3143 Name: lsrA Funciton: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component Locus tag: plu3144 Name: lsrC Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC Locus tag: plu3145 Name: lsrD Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD Locus tag: plu3146 Name: lsrB Funciton: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB Locus tag: plu3147 Name: lsrF Funciton: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) Locus tag: plu3148 Name: lsrG Funciton: Autoinducer 2 (AI-2) modifying protein LsrG
	plu3143	lsrA	Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component
	plu3144	lsrC	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC
	plu3145	lsrD	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD
	plu3146	lsrB	Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB
	plu3147	lsrF	Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-)
	plu3148	lsrG	Autoinducer 2 (AI-2) modifying protein LsrG
Position: -184 Score: 6.8 Sequence: GAACATTTATCTATTTAAAAAACAATTGTTC Locus tag: plu3142 Name: lsrR Funciton: Quorum sensing transcriptional repgulator of LsrR, SorC family Locus tag: plu3141 Name: lsrK Funciton: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)
	plu3142	lsrR	Quorum sensing transcriptional repgulator of LsrR, SorC family
	plu3141	lsrK	Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD