Regulon of LsrR in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM4073
Regulator family:	SorC
Regulation mode:	repressor
Biological process:	Quorum sensing; Biofilm formation
Effector:	4,5-dihydroxypentan-2,3-dione
Regulog:	LsrR - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - SorC
By effector - 4,5-dihydroxypentan-2,3-dione
By pathway - Quorum sensing
By pathway - Biofilm formation

Regulated operons
	Locus Tag	Name	Function
Position: -233 Score: 6.5 Sequence: GAACATTTCTAAATCATTAACACAATTGTTC Position: -67 Score: 6.6 Sequence: GAACAATTTCTTTTTCAAAAAACATTTGTTC Locus tag: STM4074 Name: lsrA Funciton: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component Locus tag: STM4075 Name: lsrC Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC Locus tag: STM4076 Name: lsrD Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD Locus tag: STM4077 Name: lsrB Funciton: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB Locus tag: STM4078 Name: lsrF Funciton: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) Locus tag: STM4079.S Name: lsrG Funciton: Autoinducer 2 (AI-2) modifying protein LsrG
	STM4074	lsrA	Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component
	STM4075	lsrC	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC
	STM4076	lsrD	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD
	STM4077	lsrB	Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB
	STM4078	lsrF	Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-)
	STM4079.S	lsrG	Autoinducer 2 (AI-2) modifying protein LsrG
Position: -219 Score: 6.6 Sequence: GAACAAATGTTTTTTGAAAAAGAAATTGTTC Position: -53 Score: 6.5 Sequence: GAACAATTGTGTTAATGATTTAGAAATGTTC Locus tag: STM4073 Name: lsrR Funciton: Quorum sensing transcriptional repgulator of LsrR, SorC family Locus tag: STM4072 Name: lsrK Funciton: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)
	STM4073	lsrR	Quorum sensing transcriptional repgulator of LsrR, SorC family
	STM4072	lsrK	Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD