Regulon of LsrR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_3537
Regulator family:	SorC
Regulation mode:	repressor
Biological process:	Quorum sensing; Biofilm formation
Effector:	4,5-dihydroxypentan-2,3-dione
Regulog:	LsrR - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - SorC
By effector - 4,5-dihydroxypentan-2,3-dione
By pathway - Quorum sensing
By pathway - Biofilm formation

Regulated operons
	Locus Tag	Name	Function
Position: -212 Score: 6 Sequence: GAACTCTTATAAAAATTTAGATCATATGTTC Position: -46 Score: 6.6 Sequence: GAACATTATTAAATCAAAAAATCATTTGTTC Locus tag: Ent638_3536 Name: lsrA Funciton: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component Locus tag: Ent638_3535 Name: lsrC Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC Locus tag: Ent638_3534 Name: lsrD Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD Locus tag: Ent638_3533 Name: lsrB Funciton: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB Locus tag: Ent638_3532 Name: lsrF Funciton: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) Locus tag: Ent638_3531 Name: lsrG Funciton: Autoinducer 2 (AI-2) modifying protein LsrG
	Ent638_3536	lsrA	Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component
	Ent638_3535	lsrC	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC
	Ent638_3534	lsrD	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD
	Ent638_3533	lsrB	Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB
	Ent638_3532	lsrF	Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-)
	Ent638_3531	lsrG	Autoinducer 2 (AI-2) modifying protein LsrG
Position: -201 Score: 6.6 Sequence: GAACAAATGATTTTTTGATTTAATAATGTTC Position: -35 Score: 6 Sequence: GAACATATGATCTAAATTTTTATAAGAGTTC Locus tag: Ent638_3537 Name: lsrR Funciton: Quorum sensing transcriptional repgulator of LsrR, SorC family Locus tag: Ent638_3538 Name: lsrK Funciton: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)
	Ent638_3537	lsrR	Quorum sensing transcriptional repgulator of LsrR, SorC family
	Ent638_3538	lsrK	Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD