Regulon of LsrR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b1512
Regulator family:	SorC
Regulation mode:	repressor
Biological process:	Quorum sensing; Biofilm formation
Effector:	4,5-dihydroxypentan-2,3-dione
Regulog:	LsrR - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - SorC
By effector - 4,5-dihydroxypentan-2,3-dione
By pathway - Quorum sensing
By pathway - Biofilm formation

Regulated operons
	Locus Tag	Name	Function
Position: -231 Score: 6.7 Sequence: GAACATATTTAAATCTTTAATGCAATTGTTC Position: -63 Score: 6.6 Sequence: GAACAAATTAAAAGCAGAAATACATTTGTTC Locus tag: b1513 Name: lsrA Funciton: Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component Locus tag: b1514 Name: lsrC Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC Locus tag: b1515 Name: lsrD Funciton: Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD Locus tag: b1516 Name: lsrB Funciton: Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB Locus tag: b1517 Name: lsrF Funciton: Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-) Locus tag: b1518 Name: lsrG Funciton: Autoinducer 2 (AI-2) modifying protein LsrG
	b1513	lsrA	Autoinducer 2 (AI-2) ABC transport system, fused AI2 transporter subunits and ATP-binding component
	b1514	lsrC	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrC
	b1515	lsrD	Autoinducer 2 (AI-2) ABC transport system, membrane channel protein LsrD
	b1516	lsrB	Autoinducer 2 (AI-2) ABC transport system, periplasmic AI-2 binding protein LsrB
	b1517	lsrF	Autoinducer 2 (AI-2) aldolase LsrF (EC 4.2.1.-)
	b1518	lsrG	Autoinducer 2 (AI-2) modifying protein LsrG
Position: -216 Score: 6.6 Sequence: GAACAAATGTATTTCTGCTTTTAATTTGTTC Position: -48 Score: 6.7 Sequence: GAACAATTGCATTAAAGATTTAAATATGTTC Locus tag: b1512 Name: lsrR Funciton: Quorum sensing transcriptional repgulator of LsrR, SorC family Locus tag: b1511 Name: lsrK Funciton: Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)
	b1512	lsrR	Quorum sensing transcriptional repgulator of LsrR, SorC family
	b1511	lsrK	Autoinducer 2 (AI-2) kinase LsrK (EC 2.7.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD