Regulog ManR - Bacteroidaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Mannose utilization; Mannosides utilization |
| Effector: | Mannose |
| Phylum: | Bacteroidetes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacteroidaceae
- By TF family - GntR/Others
- By effector - Mannose
- By pathway - Mannose utilization
- By pathway - Mannosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | ||
| Bacteroides dorei DSM 17855 | ||
| Bacteroides eggerthii DSM 20697 | 10 | 3 |
| Bacteroides fragilis NCTC 9343 | ||
| Bacteroides ovatus ATCC 8483 | 10 | 3 |
| Bacteroides plebeius DSM 17135 | ||
| Bacteroides stercoris ATCC 43183 | ||
| Bacteroides thetaiotaomicron VPI-5482 | 11 | 3 |
| Bacteroides uniformis ATCC 8492 | ||
| Bacteroides vulgatus ATCC 8482 | ||
| Bacteroides coprophilus DSM 18228 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| manR |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -119 score = 5.44144 sequence = TACTTTGTTTGAACATATAT Gene: BACEGG_01984: Predicted transcriptional regulator of Mannose utilization, GntR family |
|
*
Bacteroides ovatus ATCC 8483 Site: position = 22 score = 5.86143 sequence = TTATATGTTCATACATACTT Gene: BACOVA_03251: Predicted transcriptional regulator of Mannose utilization, GntR family |
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -108 score = 5.83282 sequence = TAGTATGTCTGAACATATAA Gene: BT2103: Predicted transcriptional regulator of Mannose utilization, GntR family |
|
|
|
Predicted transcriptional regulator of Mannose utilization, GntR family |
| CRON 2. | ||||||||||||
| manK |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -4 score = 5.60611 sequence = TATTATGTATGAACATGATA Gene: BACEGG_01986: predicted mannose kinase, ROK family |
|
*
Bacteroides ovatus ATCC 8483 Site: position = -4 score = 5.13496 sequence = AACTATGTATGAACATGATG Gene: BACOVA_03252: predicted mannose kinase, ROK family |
|
|
|
|
|
Gene: BACCOPRO_02564: predicted mannose kinase, ROK family |
predicted mannose kinase, ROK family |
| susC_Man-1 |
|
|
Gene: BACEGG_01988: TonB-dependent outer membrane transporter of mannan oligomers |
|
Gene: BACOVA_03253: TonB-dependent outer membrane transporter of mannan oligomers |
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -148 score = 5.86143 sequence = CAATATGTATATACATATAG Gene: BT2107: TonB-dependent outer membrane transporter of mannan oligomers |
|
|
|
TonB-dependent outer membrane transporter of mannan oligomers |
| susD_Man-1 |
|
|
Gene: BACEGG_01989: Outer membrane polysaccharide binding protein for mannan oligomers |
|
Gene: BACOVA_03254: Outer membrane polysaccharide binding protein for mannan oligomers |
|
|
Gene: BT2108: Outer membrane polysaccharide binding protein for mannan oligomers |
|
|
|
Outer membrane polysaccharide binding protein for mannan oligomers |
| PS51257 |
|
|
Gene: BACEGG_01990: PROKAR_LIPOPROTEIN |
|
Gene: BACOVA_03255: PROKAR_LIPOPROTEIN |
|
|
|
|
|
|
PROKAR_LIPOPROTEIN |
| BACOVA_03256 |
|
|
|
|
Gene: BACOVA_03256: Glycoside hydrolase, family 76 |
|
|
|
|
|
|
hypothetical protein |
| BACOVA_03257 |
|
|
|
|
Gene: BACOVA_03257: Glycoside hydrolase, family 76 |
|
|
|
|
|
|
hypothetical protein |
| manA |
|
|
Gene: BACEGG_01991: putative alpha-1,2-mannosidase |
|
Gene: BACOVA_03258: putative alpha-1,2-mannosidase |
|
|
Gene: BT2111: putative alpha-1,2-mannosidase |
|
|
2
Bacteroides coprophilus DSM 18228 Gene: BACCOPRO_02570: putative alpha-1,2-mannosidase Gene: BACCOPRO_02569: putative alpha-1,2-mannosidase |
putative alpha-1,2-mannosidase |
| manP |
|
|
Gene: BACEGG_01993: Predicted mannose transporter, FucP family |
|
Gene: BACOVA_03259: Predicted mannose transporter, FucP family |
|
|
Gene: BT2106: Predicted mannose transporter, FucP family |
|
|
Gene: BACCOPRO_02567: Predicted mannose transporter, FucP family |
Predicted mannose transporter, FucP family |
| BACEGG_01987 |
|
|
Gene: BACEGG_01987: hypothetical protein |
|
|
|
|
|
|
|
|
hypothetical protein |
| BACEGG_01992 |
|
|
Gene: BACEGG_01992: hypothetical protein |
|
|
|
|
|
|
|
|
hypothetical protein |
| BT2109 |
|
|
|
|
|
|
|
Gene: BT2109: Galactose-binding domain-like |
|
|
|
hypothetical protein |
| BT2110 |
|
|
|
|
|
|
|
Gene: BT2110: hypothetical protein |
|
|
|
hypothetical protein |
| BT2112 |
|
|
|
|
|
|
|
Gene: BT2112: Glycosyl hydrolases family 43 |
|
|
|
hypothetical protein |
| BT2113 |
|
|
|
|
|
|
|
Gene: BT2113: Glycosyl hydrolases family 38, putative Alpha-mannosidase |
|
|
|
Alpha-mannosidase (EC 3.2.1.24) |
| pmi |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -29 score = 5.44144 sequence = ATATATGTTCAAACAAAGTA Gene: BACEGG_01985: Mannose-6-phosphate isomerase (EC 5.3.1.8) |
|
*
Bacteroides ovatus ATCC 8483 Site: position = -4 score = 5.86143 sequence = AAGTATGTATGAACATATAA Gene: BACOVA_03250: Mannose-6-phosphate isomerase (EC 5.3.1.8) |
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -41 score = 5.83282 sequence = TTATATGTTCAGACATACTA Gene: BT2104: Mannose-6-phosphate isomerase (EC 5.3.1.8) / predicted mannose kinase, ROK family |
|
|
Gene: BACCOPRO_02563: Mannose-6-phosphate isomerase (EC 5.3.1.8) |
Mannose-6-phosphate isomerase (EC 5.3.1.8) |
| manA |
|
|
|
|
|
|
|
Gene: BT2105: putative alpha-1,2-mannosidase |
|
|
|
putative alpha-1,2-mannosidase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |