Regulon of ManR in Bacteroides ovatus ATCC 8483

Properties
Regulator type:	Transcription factor
TF locus tag:	BACOVA_03251
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Regulog:	ManR - Bacteroidaceae
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - GntR/Others
By effector - Mannose
By pathway - Mannose utilization
By pathway - Mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: 22 Score: 5.9 Sequence: TTATATGTTCATACATACTT Locus tag: BACOVA_03251 Name: manR Funciton: Predicted transcriptional regulator of Mannose utilization, GntR family
	BACOVA_03251	manR	Predicted transcriptional regulator of Mannose utilization, GntR family
Position: -4 Score: 5.9 Sequence: AAGTATGTATGAACATATAA Locus tag: BACOVA_03250 Name: pmi Funciton: Mannose-6-phosphate isomerase (EC 5.3.1.8)
	BACOVA_03250	pmi	Mannose-6-phosphate isomerase (EC 5.3.1.8)
Position: -4 Score: 5.1 Sequence: AACTATGTATGAACATGATG Locus tag: BACOVA_03252 Name: manK Funciton: predicted mannose kinase, ROK family Locus tag: BACOVA_03253 Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers Locus tag: BACOVA_03254 Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers Locus tag: BACOVA_03255 Name: PS51257 Funciton: PROKAR_LIPOPROTEIN Locus tag: BACOVA_03256 Name: PF03663 Funciton: Glycoside hydrolase, family 76 Locus tag: BACOVA_03257 Name: PF03663 Funciton: Glycoside hydrolase, family 76 Locus tag: BACOVA_03258 Name: manA Funciton: putative alpha-1,2-mannosidase Locus tag: BACOVA_03259 Name: manP Funciton: Predicted mannose transporter, FucP family
	BACOVA_03252	manK	predicted mannose kinase, ROK family
	BACOVA_03253	susC_Man-1	TonB-dependent outer membrane transporter of mannan oligomers
	BACOVA_03254	susD_Man-1	Outer membrane polysaccharide binding protein for mannan oligomers
	BACOVA_03255	PS51257	PROKAR_LIPOPROTEIN
	BACOVA_03256	PF03663	Glycoside hydrolase, family 76
	BACOVA_03257	PF03663	Glycoside hydrolase, family 76
	BACOVA_03258	manA	putative alpha-1,2-mannosidase
	BACOVA_03259	manP	Predicted mannose transporter, FucP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD