Regulon of ManR in Bacteroides eggerthii DSM 20697

Properties
Regulator type:	Transcription factor
TF locus tag:	BACEGG_01984
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Regulog:	ManR - Bacteroidaceae
Statistics of regulated genes:
- Genes	10
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - GntR/Others
By effector - Mannose
By pathway - Mannose utilization
By pathway - Mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 5.4 Sequence: ATATATGTTCAAACAAAGTA Locus tag: BACEGG_01985 Name: pmi Funciton: Mannose-6-phosphate isomerase (EC 5.3.1.8)
	BACEGG_01985	pmi	Mannose-6-phosphate isomerase (EC 5.3.1.8)
Position: -119 Score: 5.4 Sequence: TACTTTGTTTGAACATATAT Locus tag: BACEGG_01984 Name: manR Funciton: Predicted transcriptional regulator of Mannose utilization, GntR family
	BACEGG_01984	manR	Predicted transcriptional regulator of Mannose utilization, GntR family
Position: -4 Score: 5.6 Sequence: TATTATGTATGAACATGATA Locus tag: BACEGG_01986 Name: manK Funciton: predicted mannose kinase, ROK family Locus tag: BACEGG_01987 Name: null Funciton: hypothetical protein Locus tag: BACEGG_01988 Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers Locus tag: BACEGG_01989 Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers Locus tag: BACEGG_01990 Name: PS51257 Funciton: PROKAR_LIPOPROTEIN Locus tag: BACEGG_01991 Name: manA Funciton: putative alpha-1,2-mannosidase Locus tag: BACEGG_01992 Name: null Funciton: hypothetical protein Locus tag: BACEGG_01993 Name: manP Funciton: Predicted mannose transporter, FucP family
	BACEGG_01986	manK	predicted mannose kinase, ROK family
	BACEGG_01987		hypothetical protein
	BACEGG_01988	susC_Man-1	TonB-dependent outer membrane transporter of mannan oligomers
	BACEGG_01989	susD_Man-1	Outer membrane polysaccharide binding protein for mannan oligomers
	BACEGG_01990	PS51257	PROKAR_LIPOPROTEIN
	BACEGG_01991	manA	putative alpha-1,2-mannosidase
	BACEGG_01992		hypothetical protein
	BACEGG_01993	manP	Predicted mannose transporter, FucP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD