Regulon of ManR in Bacteroides thetaiotaomicron VPI-5482

Properties
Regulator type:	Transcription factor
TF locus tag:	BT2103
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Regulog:	ManR - Bacteroidaceae
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - GntR/Others
By effector - Mannose
By pathway - Mannose utilization
By pathway - Mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -148 Score: 5.9 Sequence: CAATATGTATATACATATAG Locus tag: BT2107 Name: susC_Man-1 Funciton: TonB-dependent outer membrane transporter of mannan oligomers Locus tag: BT2108 Name: susD_Man-1 Funciton: Outer membrane polysaccharide binding protein for mannan oligomers Locus tag: BT2109 Name: null Funciton: Galactose-binding domain-like Locus tag: BT2110 Name: null Funciton: hypothetical protein Locus tag: BT2111 Name: manA Funciton: putative alpha-1,2-mannosidase Locus tag: BT2112 Name: GH43 Funciton: Glycosyl hydrolases family 43 Locus tag: BT2113 Name: GH38 Funciton: Glycosyl hydrolases family 38, putative Alpha-mannosidase
	BT2107	susC_Man-1	TonB-dependent outer membrane transporter of mannan oligomers
	BT2108	susD_Man-1	Outer membrane polysaccharide binding protein for mannan oligomers
	BT2109		Galactose-binding domain-like
	BT2110		hypothetical protein
	BT2111	manA	putative alpha-1,2-mannosidase
	BT2112	GH43	Glycosyl hydrolases family 43
	BT2113	GH38	Glycosyl hydrolases family 38, putative Alpha-mannosidase
Position: -41 Score: 5.8 Sequence: TTATATGTTCAGACATACTA Locus tag: BT2104 Name: pmi-manK Funciton: Mannose-6-phosphate isomerase (EC 5.3.1.8) / predicted mannose kinase, ROK family Locus tag: BT2105 Name: manA Funciton: putative alpha-1,2-mannosidase Locus tag: BT2106 Name: manP Funciton: Predicted mannose transporter, FucP family
	BT2104	pmi-manK	Mannose-6-phosphate isomerase (EC 5.3.1.8) / predicted mannose kinase, ROK family
	BT2105	manA	putative alpha-1,2-mannosidase
	BT2106	manP	Predicted mannose transporter, FucP family
Position: -108 Score: 5.8 Sequence: TAGTATGTCTGAACATATAA Locus tag: BT2103 Name: manR Funciton: Predicted transcriptional regulator of Mannose utilization, GntR family
	BT2103	manR	Predicted transcriptional regulator of Mannose utilization, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD