Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing BT2113 gene

Properties
Regulog: ManR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Mannose utilization; Mannosides utilization
Effector: Mannose
Phylum: Bacteroidetes
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides thetaiotaomicron VPI-5482
Position: -148
Score: 5.86143
Sequence: CAATATGTATATACATATAG
Locus tag: BT2107
Name: susC_Man-1
Funciton: TonB-dependent outer membrane transporter of mannan oligomers
Locus tag: BT2108
Name: susD_Man-1
Funciton: Outer membrane polysaccharide binding protein for mannan oligomers
Locus tag: BT2109
Name: null
Funciton: Galactose-binding domain-like
Locus tag: BT2110
Name: null
Funciton: hypothetical protein
Locus tag: BT2111
Name: manA
Funciton: putative alpha-1,2-mannosidase
Locus tag: BT2112
Name: GH43
Funciton: Glycosyl hydrolases family 43
Locus tag: BT2113
Name: GH38
Funciton: Glycosyl hydrolases family 38, putative Alpha-mannosidase
susC_Man-1-susD_Man-1-BT2109-BT2110-manA-GH43-GH38 -148 5.9 CAATATGTATATACATATAG BT2107