Regulog AraR - Bacteroidaceae
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Bacteroidetes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacteroidaceae
- By TF family - NrtR
- By effector - Arabinose
- By pathway - Arabinose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides cellulosilyticus DSM 14838 | 14 | 2 |
| Bacteroides coprophilus DSM 18228 | ||
| Bacteroides dorei DSM 17855 | 6 | 1 |
| Bacteroides eggerthii DSM 20697 | 7 | 2 |
| Bacteroides fragilis NCTC 9343 | ||
| Bacteroides ovatus ATCC 8483 | 10 | 2 |
| Bacteroides plebeius DSM 17135 | 7 | 3 |
| Bacteroides stercoris ATCC 43183 | ||
| Bacteroides thetaiotaomicron VPI-5482 | 28 | 4 |
| Bacteroides uniformis ATCC 8492 | 12 | 2 |
| Bacteroides vulgatus ATCC 8482 | 6 | 1 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| abn3 |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -39 score = 5.35733 sequence = TATGTGTATTTTTGACACCCA Gene: BACCELL_00858: Arabinoxylan arabinofuranohydrolase, GH43 family |
|
|
|
|
|
|
|
|
*
Bacteroides uniformis ATCC 8492 Site: position = -96 score = 5.21675 sequence = TAAGTGTATATGTTACACAAC Site: position = -46 score = 5.3574 sequence = ATAGTGTTAATTTTACACCCG Gene: BACUNI_03327: Arabinoxylan arabinofuranohydrolase, GH43 family |
|
Arabinoxylan arabinofuranohydrolase, GH43 family |
| agaL |
Gene: BACCELL_00859: alpha-glucosidase, GH97 family |
|
|
*
Bacteroides eggerthii DSM 20697 Site: position = -46 score = 5.67312 sequence = AAGGTGTTATTTTTACACTCT Site: position = -97 score = 4.97003 sequence = CAAGTGTATATGTTACACAAC Gene: BACEGG_00165: alpha-glucosidase, GH97 family |
|
Gene: BACOVA_03484: alpha-glucosidase, GH97 family |
|
|
|
Gene: BACUNI_03328: alpha-glucosidase, GH97 family |
|
alpha-glucosidase, GH97 family |
| abf3 |
Gene: BACCELL_00860: alpha-N-arabinofuranosidase, GH51 family |
|
|
|
|
*
Bacteroides ovatus ATCC 8483 Site: position = -138 score = 5.11486 sequence = AAAGTGTATATTTTACCCTTG Site: position = -94 score = 4.77728 sequence = TAAGTGTATAATTACCAATTA Gene: BACOVA_03483: alpha-N-arabinofuranosidase, GH51 family |
|
|
|
Gene: BACUNI_03329: alpha-N-arabinofuranosidase, GH51 family |
|
alpha-N-arabinofuranosidase, GH51 family |
| SSF48208 |
|
|
|
|
|
|
|
|
|
Gene: BACUNI_03330: Six-hairpin glycosidase-like |
|
Six-hairpin glycosidase-like |
| abf4 |
Gene: BACCELL_00861: alpha-N-arabinofuranosidase, GH51 family |
|
|
|
|
|
|
|
|
Gene: BACUNI_03331: alpha-N-arabinofuranosidase, GH51 family |
|
alpha-N-arabinofuranosidase, GH51 family |
| bgaL |
Gene: BACCELL_00862: beta-galactosidase, GH2 family |
|
|
|
|
|
|
|
|
Gene: BACUNI_03332: beta-galactosidase, GH2 family |
|
beta-galactosidase, GH2 family |
| abn4 |
Gene: BACCELL_00863: arabinan endo-1,5-alpha-L-arabinosidase, GH43 family |
|
|
|
|
|
|
|
|
|
|
arabinan endo-1,5-alpha-L-arabinosidase, GH43 family |
| CRON 2. | ||||||||||||
| BT4163 |
|
|
|
|
|
|
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -329 score = 5.07565 sequence = AAATTGTATTATCTACACTCT Gene: BT4163: Fasciclin, PF02469 family |
|
|
Fasciclin, PF02469 family |
| susC_Rgu-3 |
|
|
|
|
|
|
|
|
Gene: BT4164: TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides |
|
|
TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides |
| susD_Rgu-3 |
|
|
|
|
|
|
|
|
Gene: BT4165: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides |
|
|
Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides |
| BT4166 |
|
|
|
|
|
|
|
|
Gene: BT4166: hypothetical protein, DUF5075, DUF5076 |
|
|
hypothetical protein, DUF5075, DUF5076 |
| BT4167 |
|
|
|
|
|
|
|
|
Gene: BT4167: Fasciclin domain, PF02469 family |
|
|
Fasciclin domain, PF02469 family |
| susC_Rgu-4 |
|
|
|
|
|
|
|
|
Gene: BT4168: TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides |
|
|
TonB-dependent outer membrane transporter of rhamnogalacturonan oligosaccharides |
| susD_Rgu-4 |
|
|
|
|
|
|
|
|
Gene: BT4169: Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides |
|
|
Outer membrane polysaccharide binding protein for rhamnogalacturonan oligosaccharides |
| pelL |
|
|
|
|
|
|
|
|
Gene: BT4170: Pectate lyase L (EC 4.2.2.2) |
|
|
Pectate lyase L (EC 4.2.2.2) |
| BT4171 |
|
|
|
|
|
|
|
|
Gene: BT4171: hypothetical protein, PF16408 family |
|
|
hypothetical protein, PF16408 family |
| CRON 3. | ||||||||||||
| araM |
*
Bacteroides cellulosilyticus DSM 14838 Site: position = -60 score = 5.75141 sequence = AAAGTGTTACTTTTACACCCA Site: position = -84 score = 5.56571 sequence = CAAGTGTTACTAATACACTCA Gene: BACCELL_05604: L-arabinose mutarotase |
|
*
Bacteroides dorei DSM 17855 Site: position = -122 score = 5.19825 sequence = AAAGTGTAGGAAATACACTTT Site: position = -59 score = 5.5794 sequence = ATAGTGTTACTTTTACACCCA Gene: BACDOR_03634: L-arabinose mutarotase |
*
Bacteroides eggerthii DSM 20697 Site: position = -84 score = 5.71239 sequence = AAAGTGTATATATTACACCAA Site: position = -60 score = 5.50468 sequence = AAAGTGTTACTTTTACACCCG Gene: BACEGG_01536: L-arabinose mutarotase |
|
*
Bacteroides ovatus ATCC 8483 Site: position = -84 score = 5.59526 sequence = AGAGTGTATTTGATACACCAA Site: position = -60 score = 5.75141 sequence = AAAGTGTTACTTTTACACCCA Gene: BACOVA_01715: L-arabinose mutarotase |
*
Bacteroides plebeius DSM 17135 Site: position = -45 score = 5.61214 sequence = TAAGTGTTACTTTTACACCAT Gene: BACPLE_02214: L-arabinose mutarotase |
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -84 score = 5.59526 sequence = AGAGTGTATTTGATACACCAA Site: position = -60 score = 5.75141 sequence = AAAGTGTTACTTTTACACCCA Gene: BT0356: L-arabinose mutarotase |
*
Bacteroides uniformis ATCC 8492 Site: position = -27 score = 4.20302 sequence = AAAGTGTACAGCCTACACTAA Site: position = -3 score = 5.75141 sequence = AAAGTGTTACTTTTACACCCA Gene: BACUNI_01357: L-arabinose mutarotase |
*
Bacteroides vulgatus ATCC 8482 Site: position = -122 score = 5.19825 sequence = AAAGTGTAGGAAATACACTTT Site: position = -59 score = 5.44013 sequence = ATAGTGTTACTTTTACACCAA Gene: BVU_2324: L-arabinose mutarotase |
L-arabinose mutarotase |
| araP |
Gene: BACCELL_05605: Predicted sodium-dependent arabinose transporter, MFS family |
|
Gene: BACDOR_03633: Predicted sodium-dependent arabinose transporter, MFS family |
Gene: BACEGG_01535: Predicted sodium-dependent arabinose transporter, MFS family |
|
Gene: BACOVA_01714: Predicted sodium-dependent arabinose transporter, MFS family |
*
Bacteroides plebeius DSM 17135 Site: position = -94 score = 5.60035 sequence = TTAGTGTTACTAATACACTTT Gene: BACPLE_02216: Predicted sodium-dependent arabinose transporter, MFS family |
|
Gene: BT0355: Predicted sodium-dependent arabinose transporter, MFS family |
Gene: BACUNI_01358: Predicted sodium-dependent arabinose transporter, MFS family |
Gene: BVU_2323: Predicted sodium-dependent arabinose transporter, MFS family |
Predicted sodium-dependent arabinose transporter, MFS family |
| araR |
Gene: BACCELL_05606: Transcriptional regulator for arabinose utilization, NrtR family |
|
Gene: BACDOR_03632: Transcriptional regulator for arabinose utilization, NrtR family |
Gene: BACEGG_01534: Transcriptional regulator for arabinose utilization, NrtR family |
|
Gene: BACOVA_01713: Transcriptional regulator for arabinose utilization, NrtR family |
Gene: BACPLE_02213: Transcriptional regulator for arabinose utilization, NrtR family |
|
Gene: BT0354: Transcriptional regulator for arabinose utilization, NrtR family |
Gene: BACUNI_01359: Transcriptional regulator for arabinose utilization, NrtR family |
Gene: BVU_2322: Transcriptional regulator for arabinose utilization, NrtR family |
Transcriptional regulator for arabinose utilization, NrtR family |
| araD |
Gene: BACCELL_05607: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
Gene: BACDOR_03631: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: BACEGG_01533: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
Gene: BACOVA_01712: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: BACPLE_02212: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
Gene: BT0353: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: BACUNI_01360: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: BVU_2321: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
| BT0352 |
|
|
|
|
|
|
|
|
Gene: BT0352: hypothetical protein |
|
|
hypothetical protein |
| araA |
Gene: BACCELL_05608: L-arabinose isomerase (EC 5.3.1.4) |
|
Gene: BACDOR_03630: L-arabinose isomerase (EC 5.3.1.4) |
Gene: BACEGG_01532: L-arabinose isomerase (EC 5.3.1.4) |
|
Gene: BACOVA_01711: L-arabinose isomerase (EC 5.3.1.4) |
Gene: BACPLE_02211: L-arabinose isomerase (EC 5.3.1.4) |
|
Gene: BT0351: L-arabinose isomerase (EC 5.3.1.4) |
Gene: BACUNI_01361: L-arabinose isomerase (EC 5.3.1.4) |
Gene: BVU_2320: L-arabinose isomerase (EC 5.3.1.4) |
L-arabinose isomerase (EC 5.3.1.4) |
| araB |
Gene: BACCELL_05609: Ribulokinase (EC 2.7.1.16) |
|
Gene: BACDOR_03629: Ribulokinase (EC 2.7.1.16) |
Gene: BACEGG_01531: Ribulokinase (EC 2.7.1.16) |
|
Gene: BACOVA_01710: Ribulokinase (EC 2.7.1.16) |
Gene: BACPLE_02210: Ribulokinase (EC 2.7.1.16) |
|
Gene: BT0350: Ribulokinase (EC 2.7.1.16) |
Gene: BACUNI_01362: Ribulokinase (EC 2.7.1.16) |
Gene: BVU_2319: Ribulokinase (EC 2.7.1.16) |
Ribulokinase (EC 2.7.1.16) |
| COG3533 |
Gene: BACCELL_05610: COG3533 secreted protein |
|
Gene: BACDOR_01282: COG3533 secreted protein |
Gene: BACEGG_01530: COG3533 secreted protein |
|
Gene: BACOVA_01709: COG3533 secreted protein |
|
|
Gene: BT0349: COG3533 secreted protein |
|
Gene: BVU_0490: COG3533 secreted protein |
COG3533 secreted protein |
| abf1 |
Gene: BACCELL_05611: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
|
Gene: BACDOR_00780: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
Gene: BACEGG_01529: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
|
Gene: BACOVA_01708: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
*
Bacteroides plebeius DSM 17135 Site: position = -33 score = 4.35128 sequence = AAAGTGTGAAATAAACAAGTA Site: position = -81 score = 4.52339 sequence = AAAATGTCAAATGTACACCCA Gene: BACPLE_02644: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
|
Gene: BT0348: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
|
Gene: BVU_4054: Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
Alpha-N-arabinofuranosidase (EC 3.2.1.55), GH51 family |
| CRON 4. | ||||||||||||
| PF13385 |
Gene: BACCELL_05402: Concanavalin A-like lectin/glucanases superfamily |
|
|
|
|
|
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -167 score = 5.71599 sequence = AAAGTGTAAAAAAGACACTTA Gene: BT0365: Concanavalin A-like lectin/glucanases superfamily |
|
|
Concanavalin A-like lectin/glucanases superfamily |
| susC_Ara-1 |
Gene: BACCELL_05403: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT0364: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
TonB-dependent outer membrane transporter of arabinan oligosaccharides |
| susD_Ara-1 |
Gene: BACCELL_05404: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT0363: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
| susC_Ara-2 |
Gene: BACCELL_05405: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT0362: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
TonB-dependent outer membrane transporter of arabinan oligosaccharides |
| susD_Ara-2 |
Gene: BACCELL_05406: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT0361: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
| abn1 |
Gene: BACCELL_05407: Arabinan endo-1,5-alpha-L-arabinosidase |
|
|
|
|
|
|
|
Gene: BT0360: Arabinan endo-1,5-alpha-L-arabinosidase |
|
|
Arabinan endo-1,5-alpha-L-arabinosidase |
| CRON 5. | ||||||||||||
| sbp_Ara-4 |
Gene: BACCELL_01899: ix-beta-propeller protein, cell surface exposed, putatively involved in arabinan binding |
|
|
|
|
|
|
|
*
Bacteroides thetaiotaomicron VPI-5482 Site: position = -229 score = 4.93051 sequence = ATAATGTAAAATCTACACTCA Gene: BT3047: ix-beta-propeller protein, cell surface exposed, putatively involved in arabinan binding |
|
|
ix-beta-propeller protein, cell surface exposed, putatively involved in arabinan binding |
| susC_Ara-4 |
Gene: BACCELL_01900: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT3046: TonB-dependent outer membrane transporter of arabinan oligosaccharides |
|
|
TonB-dependent outer membrane transporter of arabinan oligosaccharides |
| susD_Ara-4 |
Gene: BACCELL_01901: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
|
|
|
|
|
Gene: BT3045: Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
|
|
Outer membrane polysaccharide binding protein for arabinan oligosaccharides |
| BT3044 |
Gene: BACCELL_01902: Hypothetical protein, presumably involved in arabinan utilization |
|
|
|
|
|
|
|
Gene: BT3044: Hypothetical protein, presumably involved in arabinan utilization |
|
|
Hypothetical protein, presumably involved in arabinan utilization |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |