Regulon of AraR in Bacteroides dorei DSM 17855

Properties
Regulator type:	Transcription factor
TF locus tag:	BACDOR_03632
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	Arabinose utilization
Effector:	Arabinose
Regulog:	AraR - Bacteroidaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - NrtR
By effector - Arabinose
By pathway - Arabinose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -122 Score: 5.2 Sequence: AAAGTGTAGGAAATACACTTT Position: -59 Score: 5.6 Sequence: ATAGTGTTACTTTTACACCCA Locus tag: BACDOR_03634 Name: araM Funciton: L-arabinose mutarotase Locus tag: BACDOR_03633 Name: araP Funciton: Predicted sodium-dependent arabinose transporter, MFS family Locus tag: BACDOR_03632 Name: araR Funciton: Transcriptional regulator for arabinose utilization, NrtR family Locus tag: BACDOR_03631 Name: araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) Locus tag: BACDOR_03630 Name: araA Funciton: L-arabinose isomerase (EC 5.3.1.4) Locus tag: BACDOR_03629 Name: araB Funciton: Ribulokinase (EC 2.7.1.16)
	BACDOR_03634	araM	L-arabinose mutarotase
	BACDOR_03633	araP	Predicted sodium-dependent arabinose transporter, MFS family
	BACDOR_03632	araR	Transcriptional regulator for arabinose utilization, NrtR family
	BACDOR_03631	araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	BACDOR_03630	araA	L-arabinose isomerase (EC 5.3.1.4)
	BACDOR_03629	araB	Ribulokinase (EC 2.7.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD